Busch Lab

ZMP

ALPK3 (2 of 2)

Ensembl ID:
ENSDARG00000090375
Description:
alpha-kinase 3 [Source:HGNC Symbol;Acc:17574]
Human Orthologue:
ALPK3
Human Description:
alpha-kinase 3 [Source:HGNC Symbol;Acc:17574]
Mouse Orthologue:
Alpk3
Mouse Description:
alpha-kinase 3 Gene [Source:MGI Symbol;Acc:MGI:2151224]

Alleles

There are 6 alleles of this gene:

Allele Name Consequence Status Availability
sa34092 Nonsense Mutation detected in F1 DNA Not yet available
sa30633 Nonsense Mutation detected in F1 DNA Not yet available
sa9870 Nonsense Available for shipment Available now
sa20972 Nonsense Available for shipment Available now
sa34091 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa18304 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa34092
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125351 Nonsense 59 1869 2 12
Genomic Location (Zv9):
Chromosome 7 (position 31463238)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 29855580
GRCz11 7 30126730
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGGTACAAAGACGACATCCAGCTGGACAGATACTGCGGCCTGCCCAAATA[T/A]GAAATTTCACGTGATGACAAGACACACACACTCCAAATATACAAGTATGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30633
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125351 Nonsense 454 1869 3 12
Genomic Location (Zv9):
Chromosome 7 (position 31458154)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 29850496
GRCz11 7 30121646
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTAAAAACAAAACGGACATAACAGAAAGAAAAACAACTGAGAAACTTACA[G/T]AGAAATTGAACAAAAGTGTATCAGAAGAGTTAAAGAAAGTTCAGGATGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9870
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125351 Nonsense 547 1869 3 12
Genomic Location (Zv9):
Chromosome 7 (position 31457875)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 29850217
GRCz11 7 30121367
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AAAYRCCAGTAAAAGTAAACAAATGTGCCTCAGAAGAGTTAGAGATAAGT[C/T]AGAGTGCTAAGATCACCTCAGCGATGGAACATRGAAWCAAASTGRACATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20972
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125351 Nonsense 629 1869 3 12
Genomic Location (Zv9):
Chromosome 7 (position 31457629)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 29849971
GRCz11 7 30121121
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTGAAAAACAGTCAGTATATACAGATGAAAATGTTTCCAAAGTATCAAAT[A/T]AAGCTCAAGAAGCTCCGGGAGCCTCAGTGTCTGCCAAAGCCAAAATGGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34091
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125351 Essential Splice Site 1693 1869 10 12
Genomic Location (Zv9):
Chromosome 7 (position 31448286)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 29840628
GRCz11 7 30111778
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACTAGTTGATTCCACGTCATGTTTTGTCACTGTCACTATGTCTATTTTTC[A/T]GGGTAATTCCTCTCTACTTCACGTACTGGCCAGCAAGCAGTGTTCCTTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18304
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125351 Nonsense 1748 1869 10 12
Genomic Location (Zv9):
Chromosome 7 (position 31448121)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 29840463
GRCz11 7 30111613
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CACTGGTAMTCRATGAGAAGTCAGAGGTGGGACAAAAGTGCTCATCTCTC[C/T]AGCACTGGATCCACCAGTGGACCAGCGGAAATGTGCTGTTCTCAAGACTT
Associated Phenotype:
Not determined