Busch Lab

ZMP

ENSDARG00000090361

Ensembl ID:
ENSDARG00000090361
Human Orthologue:
MAMDC2
Human Description:
MAM domain containing 2 [Source:HGNC Symbol;Acc:23673]
Mouse Orthologue:
Mamdc2
Mouse Description:
MAM domain containing 2 Gene [Source:MGI Symbol;Acc:MGI:1918988]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa45118 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa45118
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057581 Essential Splice Site 83 147 1 3
Genomic Location (Zv9):
Chromosome 2 (position 47426190)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 47431466
GRCz11 2 47283158
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACATGTGGCATCTTGCACAGGTGGACCTAAGACCAGATGTTAAGTTCCAG[G/A]TCAGTGAAAGTTTGATAATAACCTAATCTTCTTCAGATGCTCTTTAATTA
Long Flanking Sequence:
TGCAACATCAACTGTGACTTTGAAAAAGACATTTGCACTTGGACTCAGTTGGCAACTGATGTTTTTGATTGGACAAGACAAAGAGGCTCCACCCCCACACCACTGACTGGTCCCTCCTCTGACCACACAACAGGAAGTGGGTTTTGTTTTCTAGATCTAGAATTCTACATTTTGAGCATCCAAATTATAACAATTTCCAATCTCCAAATTTATGTTTGTGTTGCTCAACTTCTTTCCCAGGTGGCTTTTATATGTACATTGAGGGTGACAGTGCCCTTCATGGTGACACAGCCCGTCTCCTCAGTGCACAATGTGCTGACCCTCAACCTCAGTGTCTTCAGTTCTGGTACCACATGTATGGCTCCAGCTGGACTATGGGCCTGAGTGTCTACTTGCTGCAATATGGTAATGTGGCCAAAGAGGTGTGGAGGAAGAGAGAAGACCAAGGAAACATGTGGCATCTTGCACAGGTGGACCTAAGACCAGATGTTAAGTTCCAG[G/A]TCAGTGAAAGTTTGATAATAACCTAATCTTCTTCAGATGCTCTTTAATTAAAGGTAAATATACTAATCTGTAGACATGTTGTTGGTCTAATAGGTGATCTTTGAGGGGCGTAGAGGAAGCTCAGAACGGTCAGATGTTGCCATTGATGACATCTCACTACACAGAGGACCCTGTAGTGGTAGGTTTCTACAGTGTGGAGACCCTTAGTAAAAACTTTGAGCTTCAGGACCACCAAGACAGCTCATTTAGCACAACAACTAGGTTTTGCAAACCGATGCCTTACTTAAAATATAAATATTTACAATTGTAAATATCTTTCAGATTTACCAAACCACGTGGTTCCACCAACACTCCCCCCACCTCCACCTCCAACAACACCACAACCTGCCCCCATCCAAACTACAGAAGTACTAAACGCCTCACCATGTAAGACCACTGTCCATCACTGCAAAGTGATCACATTCTGTTATAAGTGATGGTACCAAAAATAACATTACTGT
Associated Phenotype:
Not determined