Busch Lab

ZMP

serpina1

Ensembl ID:
ENSDARG00000090286
ZFIN ID:
ZDB-GENE-030131-1421
Description:
serine proteinase inhibitor, clade A, member 1 [Source:RefSeq peptide;Acc:NP_001071226]
Human Orthologue:
SERPINA10
Human Description:
serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 10 [Source:HGNC Sy
Mouse Orthologues:
Gm46, Serpina10
Mouse Descriptions:
predicted gene 46 Gene [Source:MGI Symbol;Acc:MGI:2684892]
serine (or cysteine) peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 10 G

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa18519 Nonsense Available for shipment Available now
sa36986 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa43393 Splice Site, Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa18519
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113927 Nonsense 19 429 1 4
ENSDART00000125398 Nonsense 24 434 2 5
Genomic Location (Zv9):
Chromosome 20 (position 10732666)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 10558340
GRCz11 20 10545580
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GGAAATATATACTGCTGTGCAATTGCTGCCTTGCTGGTAGCAACGGCCTG[G/A]GCKGCACCCCACGATGGCCATGWAGGCCATGACCATGGTAGCCACACAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36986
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113927 Essential Splice Site 318 429 2 4
ENSDART00000125398 Essential Splice Site 323 434 3 5
Genomic Location (Zv9):
Chromosome 20 (position 10733667)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 10559341
GRCz11 20 10546581
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCCATCTGCAGACACCATCTTAAGAACTGGCATGATAAACTCTTCAGAAG[G/A]TAATATTACTGATACCTCAGGATTTAGATCCATGGTCAGTTGGTTATGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43393
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Splice Site, Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113927 Splice Site, Nonsense 367 429 3 4
ENSDART00000125398 Splice Site, Nonsense 372 434 4 5
Genomic Location (Zv9):
Chromosome 20 (position 10733908)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 10559582
GRCz11 20 10546822
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACAAAGCAGATTTCTCTGGGATGACAGAGGAGGTTAAAGTAAAAGTGTCT[C/T]AGGTATGTGAGGACTTGTTTTTACTTCTTGAAGCATCACTGATGGTAAAC
Associated Phenotype:
Not determined