Busch Lab

ZMP

LOC563795

Ensembl ID:
ENSDARG00000090267
Human Orthologues:
PRSS1, PRSS3, PRSS37, U66059.56
Human Descriptions:
Trypsin-X3 [Source:UniProtKB/Swiss-Prot;Acc:Q8IYP2]
protease, serine, 1 (trypsin 1) [Source:HGNC Symbol;Acc:9475]
protease, serine, 3 [Source:HGNC Symbol;Acc:9486]
protease, serine, 37 [Source:HGNC Symbol;Acc:29211]
Mouse Orthologues:
1700074P13Rik, 1810009J06Rik, 2210010C04Rik, AC161768.1, BC048599, Gm10334, Gm4744, Gm5771, Prss1, Prss2, Prss3, Prss37, Try10, Try4, Try5
Mouse Descriptions:
RIKEN cDNA 1700074P13 gene Gene [Source:MGI Symbol;Acc:MGI:1920731]
RIKEN cDNA 1810009J06 gene Gene [Source:MGI Symbol;Acc:MGI:1920876]
RIKEN cDNA 2210010C04 gene Gene [Source:MGI Symbol;Acc:MGI:1914623]
cDNA sequence BC048599 Gene [Source:MGI Symbol;Acc:MGI:3608323]
predicted gene 10334 Gene [Source:MGI Symbol;Acc:MGI:3641889]
predicted gene 4744 Pseudogene [Source:MGI Symbol;Acc:MGI:3643181]
predicted gene 5771 Gene [Source:MGI Symbol;Acc:MGI:3646222]
protease, serine, 1 (trypsin 1) Gene [Source:MGI Symbol;Acc:MGI:98839]
protease, serine, 2 Gene [Source:MGI Symbol;Acc:MGI:102759]
protease, serine, 3 Gene [Source:MGI Symbol;Acc:MGI:102758]
protease, serine, 37 Gene [Source:MGI Symbol;Acc:MGI:1914940]
trypsin 10 Gene [Source:MGI Symbol;Acc:MGI:3687012]
trypsin 4 Gene [Source:MGI Symbol;Acc:MGI:102757]
trypsin 5 Gene [Source:MGI Symbol;Acc:MGI:102756]
trypsinogen 4 [Source:RefSeq peptide;Acc:NP_001096130]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa42723 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa42723
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128910 Nonsense 208 243 5 5
Genomic Location (Zv9):
Chromosome 16 (position 27374087)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 25219774
GRCz11 16 25134806
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACTTTTCTCAGGGTGACTCTGGTGGTCCGCTTGTGTGCAATGGTGAACTA[C/T]GAGGAGTTGTTTCGTGGGGTGCAGGCTGTGCTGAACCAGGATATCCTGCA
Associated Phenotype:
Not determined