Busch Lab

ZMP

si:dkey-71d15.3

Ensembl ID:
ENSDARG00000090202
ZFIN ID:
ZDB-GENE-091204-317
Human Orthologue:
RBM11
Human Description:
RNA binding motif protein 11 [Source:HGNC Symbol;Acc:9897]
Mouse Orthologue:
Rbm11
Mouse Description:
RNA binding motif protein 11 Gene [Source:MGI Symbol;Acc:MGI:2447622]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa16126 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa16126
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128830 Nonsense 7 212 1 6
ENSDART00000132711 None None 116 None 4
ENSDART00000139635 Nonsense 7 186 1 5
Genomic Location (Zv9):
Chromosome 21 (position 33942605)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 34942298
GRCz11 21 34976788
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GTTTCAACTCTTTTGGCAAGAGCTTTAAAGWATGTCGAGGCATTTATCCT[T/A]ATCAAACAAGACCATCATTGTGGGAAACCYCCACAGATGTGTGACGGAGG
Associated Phenotype:
Not determined