Busch Lab

ZMP

zgc:92666

Ensembl ID:
ENSDARG00000090183
ZFIN ID:
ZDB-GENE-040718-117
Description:
Zgc:92666 [Source:UniProtKB/TrEMBL;Acc:Q6DH32]
Human Orthologue:
GAPVD1
Human Description:
GTPase activating protein and VPS9 domains 1 [Source:HGNC Symbol;Acc:23375]
Mouse Orthologue:
Gapvd1
Mouse Description:
GTPase activating protein and VPS9 domains 1 Gene [Source:MGI Symbol;Acc:MGI:1913941]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa9027 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa9027
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112854 Essential Splice Site 743 1472 12 27
ENSDART00000113230 None None 512 None 7
Genomic Location (Zv9):
Chromosome 8 (position 35198921)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 34451526
GRCz11 8 34369588
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGAGACCACGAGCGAGGCTTGGAGTGTGGAGGTTCTGCCGAGTGACTCAG[G/T]TGAGGGATAAAAGCATGTGTATTCAGCACATCTTCTGGTGAGCTCTGTTA
Associated Phenotype:
Not determined