Busch Lab

ZMP

ENSDARG00000090093

Ensembl ID:
ENSDARG00000090093

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa27527 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa27527
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124503 Nonsense 51 281 1 1
Genomic Location (Zv9):
Chromosome 10 (position 1025349)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 1093524
GRCz11 10 1097979
KASP Assay ID:
2260-2705.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TATTGTCAACTCTGTTACTGTCAACTCTGTTACTGTCTGTTAACCCTGTA[T/A]TGTCAACTCTGTTACTGTCTGTTAACCCTGTATTGTCAACTGTTACTGTC
Associated Phenotype:
Not determined