Busch Lab

ZMP

si:ch211-233f10.4

Ensembl ID:
ENSDARG00000090068
ZFIN ID:
ZDB-GENE-060526-118
Description:
Uncharacterized protein C9orf117 homolog [Source:UniProtKB/Swiss-Prot;Acc:A2BDR7]
Human Orthologue:
C9orf117
Human Description:
chromosome 9 open reading frame 117 [Source:HGNC Symbol;Acc:27843]
Mouse Orthologue:
1700019L03Rik
Mouse Description:
RIKEN cDNA 1700019L03 gene Gene [Source:MGI Symbol;Acc:MGI:2447809]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa40587 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa13152 Essential Splice Site Available for shipment Available now
sa26609 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa40587
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130638 Essential Splice Site 284 471 5 8
Genomic Location (Zv9):
Chromosome 5 (position 67676279)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 64477920
GRCz11 5 65166917
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTCTTAATATATCTATATCCTAGAGCAAAATAAAGTCAAAGTCTTTCTCC[A/T]GGTGGTCCTTCAGTTGACAGAAAAGTGCAAGCAAATGCAGTCTGAAGTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13152
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130638 Essential Splice Site 327 471 6 8
Genomic Location (Zv9):
Chromosome 5 (position 67676497)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 64478138
GRCz11 5 65167135
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TAAATACACCCAAGGGTGCATTTTAATAGCGTTACTCCCGCTGTATTACA[G/T]AAAGAAACATGCAGCGGTTACWGAAGACCTGAACCAAACCAAAGCTGAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa26609
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130638 Nonsense 393 471 7 8
Genomic Location (Zv9):
Chromosome 5 (position 67676763)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 64478404
GRCz11 5 65167401
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TACAGGACGTCCCAGAGGAGGAAGACTCTGAGCTGAAGGTCACCGTCAGA[C/T]GAAGTCAGATGATGCAGAAGCTGCTGGCTGTTCTGGACGGCGCTGCAGCT
Associated Phenotype:
Not determined