Busch Lab

ZMP

TDRD6 (2 of 2)

Ensembl ID:
ENSDARG00000089954
Description:
tudor domain containing 6 [Source:HGNC Symbol;Acc:21339]
Human Orthologue:
TDRD6
Human Description:
tudor domain containing 6 [Source:HGNC Symbol;Acc:21339]
Mouse Orthologue:
Tdrd6
Mouse Description:
tudor domain containing 6 Gene [Source:MGI Symbol;Acc:MGI:2679727]

Alleles

There are 7 alleles of this gene:

Allele Name Consequence Status Availability
sa42864 Nonsense Mutation detected in F1 DNA Not yet available
sa36303 Nonsense Mutation detected in F1 DNA Not yet available
sa22990 Nonsense Available for shipment Available now
sa42863 Nonsense Mutation detected in F1 DNA Not yet available
sa39141 Nonsense Mutation detected in F1 DNA Not yet available
sa13845 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa42864
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000129555 Nonsense 309 1388 1 5
Genomic Location (Zv9):
Chromosome 17 (position 6376316)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 6455252
GRCz11 17 6612482
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGTGTGATGGGTCTCCATGTGCAACAAAAGGTAGCGACGGGAAATGGTAC[C/T]GATCGGTTCTTCAGCAGAATGACATCTCAGATGTTGTCAAGGTCTTTCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36303
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000129555 Nonsense 375 1388 1 5
Genomic Location (Zv9):
Chromosome 17 (position 6376116)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 6455052
GRCz11 17 6612282
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CATGGTGTAATTGACAAAGGTGTTGGATGGCGGACAGATCAGATAGATTA[T/G]CTGAAATCTGTCATACTGGATCAAATCCTTGTTGGAAAGTTCGAGCACTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22990
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000129555 Nonsense 531 1388 1 5
Genomic Location (Zv9):
Chromosome 17 (position 6375648)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 6454584
GRCz11 17 6611814
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCCAAGATGAAGCTACACATAACCTGTGTGCAAAGCGTGAACCAGTTTTA[T/A]GGCCATTTTGCACAAAATACTGACGCCGTAACAAAAATGACCAAAGATAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42863
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000129555 Nonsense 788 1388 5 5
Genomic Location (Zv9):
Chromosome 17 (position 6374144)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 6453080
GRCz11 17 6610310
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTGCACAAGAAATTGGAAACAGTAGTCACACGAAAGCAATCCAGCCAGAT[C/T]AGTTACGCCAAGGTGGAATTTGTTTGGCTCGCTTTTCTGACCAGCTCTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39141
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000129555 Nonsense 1120 1388 5 5
Genomic Location (Zv9):
Chromosome 17 (position 6373146)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 6452082
GRCz11 17 6609312
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTTGACGAACATCTGCTGTCATACCCAAGGTTCAGCATTCACTGCAGCTA[T/G]AGTTTAAATGACCAATTCAAGGGAATGAAGAAGCAGGAAATTCTCTTCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13845
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000129555 Nonsense 1338 1388 5 5
Genomic Location (Zv9):
Chromosome 17 (position 6372494)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 6451430
GRCz11 17 6608660
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TCCTGTGTCGGTTGGAAGGATTTAATCCCTCTGGAGGATYGTGGGATAGT[G/T]AGGCTACTGATAACTTCTACGAACTCTTGGTGGATAAACCTCTGAAAGTG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa28792
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000129555 Nonsense 1345 1388 5 5
Genomic Location (Zv9):
Chromosome 17 (position 6372473)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 6451409
GRCz11 17 6608639
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTAATCCCTCTGGAGGATCGTGGGATAGTGAGGCTACTGATAACTTCTAC[G/T]AACTCTTGGTGGATAAACCTCTGAAAGTGAGTGTGCAGTGTATTGATGAT
Associated Phenotype:
Not determined