Busch Lab

ZMP

FCHSD2 (2 of 6)

Ensembl ID:
ENSDARG00000089928
Description:
FCH and double SH3 domains 2 [Source:HGNC Symbol;Acc:29114]
Human Orthologue:
FCHSD2
Human Description:
FCH and double SH3 domains 2 [Source:HGNC Symbol;Acc:29114]
Mouse Orthologue:
Fchsd2
Mouse Description:
FCH and double SH3 domains 2 Gene [Source:MGI Symbol;Acc:MGI:2448475]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa6495 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa28951
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123077 Essential Splice Site 56 175 4 6
Genomic Location (Zv9):
Chromosome 18 (position 1950082)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 2475912
GRCz11 18 2444029
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGGTTACATTCCAGCATTTCACAGCGTTTACTGTTGTTTTACTGTTTTTC[A/C]GGCCCTGCAGAAGTTGGCGAGTCAATATTTGAAGAGAGACTGGCCTGGGA
Long Flanking Sequence:
TTCTCATTTTAAAAAACGCTGCTGCTCCGTGTTAGTTATATTCATTCATTTATTTTCCTTCGGCATAGTCCCTTCATCCTTCAGGGGTCACCACAGCGGAATGAACCGCCAACTTATCCAGCATATGTTTTATGCAGCAGATGCCTTTCCAGCTGCAACCCGGTATGGGGTAAACACCCATACACACTCACACACTAAGGCCAATATTAGTTTATTCAGTTCACCTATAGCGCATGTGTTTGGACTGTGGGAACCCCACGCTAACACAGGCACAACATGCAAACTCCACTCAGAGATGCCAACTGAGCCAGACGGGACTCGAACCAGTGACTTTTTTGCTTTGAGGCGACATTGCGTCCACTGAGCCACCATGCTGTCTATACGGACATAAATGGAGTGTGACTTTTATATGCACTGATTTGTATTTTGCAGACTATGGACAGGTTAATCTGGTTACATTCCAGCATTTCACAGCGTTTACTGTTGTTTTACTGTTTTTC[A/C]GGCCCTGCAGAAGTTGGCGAGTCAATATTTGAAGAGAGACTGGCCTGGGATTAAACCAGACGATCAGAGGACAGACTACAGGTGAGGGAAAACACTACAAATCTATGGCTATCAGCGCTGTGAGAGTCCCAAAAACAGGCATAACTAATTTAATAAGAAGATATCCAATGATGTGCTGTGGTCCTCTCTTATATTGCAGATGTAATATTTGGCTTCCTACTGTAATTATATCAAAACTCAACTTTTGATTTGTAATATACATAGCAAAGCACTTAAATTTAGACCTCTTTAATGGTCATTTTATTAATTTTAAATTTTTTTGAACACTCAGATTTTTATATACTCTAAATATTGTCCTATCAAACCAATGATCAATTGAAACCTTTCTTATTCAGCTTTCAGGTGATGTATAAATCTTATGACTGGTTTTGTGGTCTCGGGTGCAAAAAAAATGCATGAAAAGCAAGAAATTTTATTTTTAAATATTAAAAAGTCATCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6495
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123077 Essential Splice Site 82 175 4 6
Genomic Location (Zv9):
Chromosome 18 (position 1949999)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 2475829
GRCz11 18 2443946
KASP Assay ID:
554-4696.1 (used for ordering genotyping assays)
KASP Sequence:
AGAGAGACTGGCCTGGGATWAAACCAGACGATCAGAGGACAGACTACAGG[T/C]GAGGGAAAACACTACAAATCTATGGCWATCAGCGCTGTGAGRGYCCCAAA
Long Flanking Sequence:
GGGGTCACCACAGCGGAATGAACCGCCAACTTATCCAGCATATGTTTTATGCAGCAGATGCCTTTCCAGCTGCAACCCGGTATGGGGTAAACACCCATACACACTCACACACTAAGGCCAATATTAGTTTATTCAGTTCACCTATAGCGCATGTGTTTGGACTGTGGGAACCCCACGCTAACACAGGCACAACATGCAAACTCCACTCAGAGATGCCAACTGAGCCAGACGGGACTCGAACCAGTGACTTTTTTGCTTTGAGGCGACATTGCGTCCACTGAGCCACCATGCTGTCTATACGGACATAAATGGAGTGTGACTTTTATATGCACTGATTTGTATTTTGCAGACTATGGACAGGTTAATCTGGTTACATTCCAGCATTTCACAGCGTTTACTGTTGTTTTACTGTTTTTCAGGCCCTGCAGAAGTTGGCGAGTCAATATTTGAAGAGAGACTGGCCTGGGATTAAACCAGACGATCAGAGGACAGACTACAGG[T/C]GAGGGAAAACACTACAAATCTATGGCTATCAGCGCTGTGAGAGTCCCAAAAACAGGCATAACTAATTTAATAAGAAGATATCCAATGATGTGCTGTGGTCCTCTCTTATATTGCAGATGTAATATTTGGCTTCCTACTGTAATTATATCAAAACTCAACTTTTGATTTGTAATATACATAGCAAAGCACTTAAATTTAGACCTCTTTAATGGTCATTTTATTAATTTTAAATTTTTTTGAACACTCAGATTTTTATATACTCTAAATATTGTCCTATCAAACCAATGATCAATTGAAACCTTTCTTATTCAGCTTTCAGGTGATGTATAAATCTTATGACTGGTTTTGTGGTCTCGGGTGCAAAAAAAATGCATGAAAAGCAAGAAATTTTATTTTTAAATATTAAAAAGTCATCATTTATTGAAACTATATATCATATTTATTATTTATGACTGATAAAAATATGTGATTTGTCACTTTTTTTGATTTATGAACTTCTT
Associated Phenotype:
Not determined