Busch Lab

ZMP

aldh2a

Ensembl ID:
ENSDARG00000089924
ZFIN IDs:
ZDB-GENE-040426-1262, ZDB-GENE-050417-465, ZDB-GENE-050417-465
Description:
aldehyde dehydrogenase 2 precursor [Source:RefSeq peptide;Acc:NP_956784]
Human Orthologue:
ALDH2
Human Description:
aldehyde dehydrogenase 2 family (mitochondrial) [Source:HGNC Symbol;Acc:404]
Mouse Orthologue:
Aldh2
Mouse Description:
aldehyde dehydrogenase 2, mitochondrial Gene [Source:MGI Symbol;Acc:MGI:99600]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3544
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016808 Essential Splice Site 226 516 6 13
ENSDART00000139483 Essential Splice Site 226 516 6 13
Genomic Location (Zv9):
Chromosome 5 (position 72448021)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 68809353
GRCz11 5 69581905
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GGAGCAGACGCCGCTCACCGCACTGTATATYGCCAGTTTAATCAAAGAGG[T/C]GAATGACATTCAGACCTACTGAATAATTGCAAAATAACACTGTGATGATG
Associated Phenotype:
Not determined