Busch Lab

ZMP

CACNA1G

Ensembl ID:
ENSDARG00000089913
Description:
calcium channel, voltage-dependent, T type, alpha 1G subunit [Source:HGNC Symbol;Acc:1394]
Human Orthologue:
CACNA1G
Human Description:
calcium channel, voltage-dependent, T type, alpha 1G subunit [Source:HGNC Symbol;Acc:1394]
Mouse Orthologue:
Cacna1g
Mouse Description:
calcium channel, voltage-dependent, T type, alpha 1G subunit Gene [Source:MGI Symbol;Acc:MGI:1201678

Alleles

There are 10 alleles of this gene:

Allele Name Consequence Status Availability
sa16676 Nonsense Available for shipment Available now
sa35306 Nonsense Mutation detected in F1 DNA Not yet available
sa42044 Nonsense Mutation detected in F1 DNA Not yet available
sa27964 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa35307 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa42045 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa16676
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123534 Nonsense 528 2389 8 36
Genomic Location (Zv9):
Chromosome 12 (position 29473615)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 27811224
GRCz11 12 27902584
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ATCACCACCACCACCTCCACCATCACTATCATTTGGGCAATGGGAGTGTC[C/T]GATCTGACGGGGGACGAGAGGTGGACAATCCTTYGCAGAGTGGCATTGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35306
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123534 Nonsense 623 2389 8 36
Genomic Location (Zv9):
Chromosome 12 (position 29473901)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 27811510
GRCz11 12 27902870
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTCAGTGCCCTTTGCAGCTCCAGTACATAAGAACTACCCCACTTTACAGT[C/A]ATCTCTGGCCTTAGAGCAGCTCAGACAGAGAATCCTGGATCCTGCTAGTG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27963
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123534 Essential Splice Site 841 2389 11 36
Genomic Location (Zv9):
Chromosome 12 (position 29497341)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 27834950
GRCz11 12 27926310
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATATATATATATATATATATATCAGATATGTGTGTTTATGTATGTTGACA[G/A]TGTTTGGGAGATTGTTGGCCAGCAGGGAGGAGGTTTATCGGTGCTGAGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42044
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123534 Nonsense 976 2389 13 36
Genomic Location (Zv9):
Chromosome 12 (position 29499267)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 27836876
GRCz11 12 27928236
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCTCCTGTGGCTGCTCTGTACTTCATCGCCCTCATGACCTTTGGGAATTA[T/A]GTCTTGTTTAACCTCTTAGTTGCTATCTTAGTGGAGGGATTCCAAACAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa27964
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123534 Essential Splice Site 1363 2389 20 36
Genomic Location (Zv9):
Chromosome 12 (position 29543806)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 27881415
GRCz11 12 27972775
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGTCCAACTACATATTTACTGCCATCTTTGTGACCGAAATGACAATAAAG[G/T]TAGGTGACGGGTCTCTGTGTGGCATCTACTCTGACAGAGGGTAAACTAAC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa6255
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123534 Essential Splice Site 1540 2389 25 36
Genomic Location (Zv9):
Chromosome 12 (position 29577168)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 27914777
GRCz11 12 28006137
KASP Assay ID:
554-4548.1 (used for ordering genotyping assays)
KASP Sequence:
GCAAACTAGCCTAAYCTGTACTCATTCATGTTGGTGTTTATCTGTTTTGT[A/G]GCCCGTCATGAATTACAACCCATGGATGCTGCTCTATTTTATCTCCTTCT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27965
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123534 Nonsense 1602 2389 25 36
Genomic Location (Zv9):
Chromosome 12 (position 29577356)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 27914965
GRCz11 12 28006325
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAGAAGCCAAACGGCGAGAAGCGAAGCGCCAGAAACGACGTGATAAAAAA[C/T]GAAGGAGTAAGGAGAAGGAGCTAGCTGGTCGGTAGCCTTTCCACACCTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35307
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123534 Essential Splice Site 1603 2389 25 36
Genomic Location (Zv9):
Chromosome 12 (position 29577363)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 27914972
GRCz11 12 28006332
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAAACGGCGAGAAGCGAAGCGCCAGAAACGACGTGATAAAAAACGAAGGA[G/A]TAAGGAGAAGGAGCTAGCTGGTCGGTAGCCTTTCCACACCTTTCTGAGTC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27966
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123534 Nonsense 1717 2389 29 36
Genomic Location (Zv9):
Chromosome 12 (position 29608762)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 27946281
GRCz11 12 28037237
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTATCAAGTGTCTTCACACAGATGGAACCAGTTGGATCTGGCCATTGTTT[T/A]GTTGTCTATCATGGGCATAACACTGGAGGAAATCGAGGTCAACGCTTCCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42045
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123534 Essential Splice Site 2049 2389 34 36
Genomic Location (Zv9):
Chromosome 12 (position 29632337)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 27969856
GRCz11 12 28068108
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AACTCAAACCACAGCACCCACACAACCTCACCTCACCTCGCTCAGACAGG[T/C]GCAGCACCGTATTTTACTTCTACATCTGATTTAACCGTGGTTGTTAATGC
Associated Phenotype:
Not determined