Busch Lab

ZMP

C3orf63 (2 of 2)

Ensembl ID:
ENSDARG00000089893
Description:
chromosome 3 open reading frame 63 [Source:HGNC Symbol;Acc:30314]
Human Orthologue:
C3orf63
Human Description:
chromosome 3 open reading frame 63 [Source:HGNC Symbol;Acc:30314]
Mouse Orthologue:
D14Abb1e
Mouse Description:
DNA segment, Chr 14, Abbott 1 expressed Gene [Source:MGI Symbol;Acc:MGI:1921694]

Alleles

There are 7 alleles of this gene:

Allele Name Consequence Status Availability
sa37576 Nonsense Mutation detected in F1 DNA Not yet available
sa37577 Nonsense Mutation detected in F1 DNA Not yet available
sa24227 Nonsense Available for shipment Available now
sa10514 Nonsense Available for shipment Available now
sa43890 Splice Site, Nonsense Mutation detected in F1 DNA Not yet available
sa43891 Nonsense Mutation detected in F1 DNA Not yet available
sa9869 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa37576
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000129848 Nonsense 53 1547 3 21
Genomic Location (Zv9):
Chromosome 22 (position 42053548)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 39021451
GRCz11 22 39008035
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCTGTACGTCAGGGTCGGGTGAAGAGCGTGCACGACTGTATATCCCGATA[T/A]CCAGATAACCGCACGTCCAGAGGGATTGATCCCACACCTAAATTTGACAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37577
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000129848 Nonsense 82 1547 3 21
Genomic Location (Zv9):
Chromosome 22 (position 42053634)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 39021537
GRCz11 22 39008121
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACCTAAATTTGACAGCCATTTCTCCAAGAGCTCGACTCGCGTGACGTCCT[C/A]ACAGTCACACATGGCTTTTGAGTATACGCAGGTAAAAATAAGCAGACTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24227
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000129848 Nonsense 949 1547 14 21
Genomic Location (Zv9):
Chromosome 22 (position 42069606)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 39037509
GRCz11 22 39024093
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATGAGGTCAGTGGTAGTTCAGTTGCGGAGACTACGGAAGCTGATGAGGGT[C/T]AAACGTCATGCTCAGCTGTCCCTGCTGAAGACACCTCGGTGGACCACACG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10514
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000129848 Nonsense 992 1547 14 21
Genomic Location (Zv9):
Chromosome 22 (position 42069735)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 39037638
GRCz11 22 39024222
KASP Assay ID:
2261-7149.1 (used for ordering genotyping assays)
KASP Sequence:
AGCTGCAGCCTGAGATGATCACTAACCTGGTGGAGATCCTTAAAGGAGTG[C/T]AGAAGAACTCKGTTTACTTCTACATCCATTCCCTGGAGGAGGAGAGTGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43890
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Splice Site, Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000129848 Splice Site, Nonsense 1109 1547 16 21
Genomic Location (Zv9):
Chromosome 22 (position 42073109)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 39041012
GRCz11 22 39027596
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GATTTATTGTGTCAGATGAGGATGTCCTGAATCCGTCCGTCATTACAGCA[G/T]GTAACCTGATTATCCAGTCTGGTGTATTACTAAGATCAGGTTTGATCTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43891
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000129848 Nonsense 1283 1547 20 21
Genomic Location (Zv9):
Chromosome 22 (position 42078258)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 39046161
GRCz11 22 39032745
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGGACTCCAACCAGGATTCTTCAGATAACACAGTATCTGCCCCCGTATCT[C/T]AGATGACCAGCGCTCTTACAGACCAACAAGCTGACTTCCATCCTTCTGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9869
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000129848 Nonsense 1368 1547 20 21
Genomic Location (Zv9):
Chromosome 22 (position 42078515)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 39046418
GRCz11 22 39033002
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GTGGACCCTCACCAGAGCTTCCTYGCTCACAGTGCTCTGCCAGATTCCTA[T/A]TGTCTGAGCTCTCCAGAWATCCACAGTCTGCCASAGACGCCAGYCTCGTA
Associated Phenotype:
Not determined