Busch Lab

ZMP

sf3b3

Ensembl ID:
ENSDARG00000089880
ZFIN ID:
ZDB-GENE-040426-2901
Description:
Splicing factor 3B subunit 3 [Source:UniProtKB/Swiss-Prot;Acc:Q1LVE8]
Human Orthologue:
SF3B3
Human Description:
splicing factor 3b, subunit 3, 130kDa [Source:HGNC Symbol;Acc:10770]
Mouse Orthologue:
Sf3b3
Mouse Description:
splicing factor 3b, subunit 3 Gene [Source:MGI Symbol;Acc:MGI:1289341]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa45636 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa29015
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122831 Nonsense 624 1217 15 26
ENSDART00000147743 Nonsense 624 1217 16 27

The following transcripts of ENSDARG00000089880 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 18 (position 18348706)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 18577234
GRCz11 18 18566300
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTTAATGGTCCTTTGTGTCAAGTGTGTAATGTCTTTGTTGCACAGGACTG[T/A]TTGCAGCCATTAAGTATGCAGGCTCTTCCAGCCCAGCCAGAGTCTCTTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45636
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122831 Essential Splice Site 1088 1217 None 26
ENSDART00000147743 Essential Splice Site 1088 1217 None 27

The following transcripts of ENSDARG00000089880 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 18 (position 18337393)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 18565937
GRCz11 18 18555003
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAACAAAGCATTGTGGGACAGAGGCTTGCTTAACGGAGCTTCACAGAAGG[T/G]ATACGTTTCTACTACCCTCAATTTCTCATTTCCCACAGGTCCCGGAAACT
Associated Phenotype:
Not determined