Busch Lab

ZMP

B8LFE8_DANRE

Ensembl ID:
ENSDARG00000089878
Description:
NEDD9 [Source:UniProtKB/TrEMBL;Acc:B8LFE8]
Human Orthologue:
NEDD9
Human Description:
neural precursor cell expressed, developmentally down-regulated 9 [Source:HGNC Symbol;Acc:7733]
Mouse Orthologue:
Nedd9
Mouse Description:
neural precursor cell expressed, developmentally down-regulated gene 9 Gene [Source:MGI Symbol;Acc:M

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa23415 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa23415
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125673 Nonsense 561 783 5 7
ENSDART00000126530 Nonsense 561 783 5 7
Genomic Location (Zv9):
Chromosome 19 (position 4273938)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 3762322
GRCz11 19 3703220
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTATCGCACGACAAAGCCAACATGAACAGCGAGAAGTGCGTTAAGAGCTG[G/A]ATGGATGATTATGACTACGTTCATCTCCAGGTAGAAATCACTTTAAAAGC
Associated Phenotype:
Not determined