Busch Lab

ZMP

ATXN7L1

Ensembl ID:
ENSDARG00000089860
Description:
ataxin 7-like 1 [Source:HGNC Symbol;Acc:22210]
Human Orthologue:
ATXN7L1
Human Description:
ataxin 7-like 1 [Source:HGNC Symbol;Acc:22210]
Mouse Orthologue:
Atxn7l1
Mouse Description:
ataxin 7-like 1 Gene [Source:MGI Symbol;Acc:MGI:3584458]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa8718 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa8718
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122605 Nonsense 402 593 7 9
Genomic Location (Zv9):
Chromosome 4 (position 3313408)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 3429210
GRCz11 4 3442537
KASP Assay ID:
2259-4377.1 (used for ordering genotyping assays)
KASP Sequence:
TTCAGCAGTCGGCTGATGGGACGGGGTCATTACGTGTTTGACAGRCGGTG[G/A]GATCGGGTGAGGCTGGCGCTTCACTGCATGGTGGAGAAACACGTCAACTC
Associated Phenotype:
Not determined