Busch Lab

ZMP

ENSDARG00000089842

Ensembl ID:
ENSDARG00000089842

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa44624 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa44624
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000121653 Nonsense 74 286 2 2
ENSDART00000123393 Nonsense 69 281 3 3
Genomic Location (Zv9):
Chromosome 5 (position 66280795)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 62387578
GRCz11 5 63080969
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AACCTGGAGTCAATGGACATTACAACTGTTCTGCCTGTGGAAAGATCTAC[A/T]AACATAAATCAGGTTTTTACAGACACAAGCGATTTCACACTGGAAAAGGA
Associated Phenotype:
Not determined