Busch Lab

ZMP

SLC35D2

Ensembl ID:
ENSDARG00000089837
Description:
solute carrier family 35, member D2 [Source:HGNC Symbol;Acc:20799]
Human Orthologue:
SLC35D2
Human Description:
solute carrier family 35, member D2 [Source:HGNC Symbol;Acc:20799]
Mouse Orthologue:
Slc35d2
Mouse Description:
solute carrier family 35, member D2 Gene [Source:MGI Symbol;Acc:MGI:1917734]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa21170 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa21170
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127252 Essential Splice Site 114 315 5 12
Genomic Location (Zv9):
Chromosome 8 (position 1260734)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 1126322
GRCz11 8 1192065
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAAAATTCACTATTTTACTCACCATGATCATGGAGTCGAGGATACTCAAG[T/A]ATGTACATTCATTTACAAGTTTAATAATGTGTATAACTATTCATAATGAT
Associated Phenotype:
Not determined