Busch Lab

ZMP

si:ch73-77l8.1

Ensembl ID:
ENSDARG00000089833
ZFIN ID:
ZDB-GENE-091118-116
Human Orthologue:
ASB13
Human Description:
ankyrin repeat and SOCS box-containing 13 [Source:HGNC Symbol;Acc:19765]
Mouse Orthologue:
Asb13
Mouse Description:
ankyrin repeat and SOCS box-containing 13 Gene [Source:MGI Symbol;Acc:MGI:2145525]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa34319 Nonsense Available for shipment Available now
hu2546 Nonsense Confirmed mutation in F2 line Not yet available
sa34320 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa34319
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126824 Nonsense 66 294 2 6
Genomic Location (Zv9):
Chromosome 8 (position 11562135)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 11106989
GRCz11 8 11144694
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCTGTCAACATTGTGGCCGTGGACTCCATCACTCCCCTCCATGAGGCCTG[T/A]ATTCAGGGCCATACGCAGTGTGTGAAGCTGCTTCTGGATGCTGGAGCTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
hu2546
Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126824 Nonsense 68 294 2 6
Genomic Location (Zv9):
Chromosome 8 (position 11562139)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 11106985
GRCz11 8 11144690
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCAACATTGTGGCCGTGGACTCCATCACTCCCCTCCATGAGGCCTGTATT[C/T]AGGGCCATACGCAGTGTGTGAAGCTGCTTCTGGATGCTGGAGCTCATGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34320
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126824 Nonsense 276 294 6 6
Genomic Location (Zv9):
Chromosome 8 (position 11569945)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 11099179
GRCz11 8 11136884
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCCTCGGGAAAAGAGCGCTGGGGGTTTTCACTCAACTGGGACTCCCAAAC[C/T]GAATCATCTGGTTCCTCTCTTATTTACCGGCTCCTCCTATGGAGCTCCTC
Associated Phenotype:
Not determined