Busch Lab

ZMP

ENSDARG00000089821

Ensembl ID:
ENSDARG00000089821

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa9072 Nonsense Mutation detected in F1 DNA Not yet available
sa18868 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa9072
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130347 Nonsense 148 648 5 19
ENSDART00000130347 Nonsense 148 648 5 19
Genomic Location (Zv9):
Chromosome 7 (position 20929159)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 19519595
GRCz11 7 19771563
KASP Assay ID:
2259-8646.1 (used for ordering genotyping assays)
KASP Sequence:
GTGCAAAGTGCAGTGCCRTCCTTTCCTCTGCAAGCAGCCCAGTCACAAAC[C/T]AATCAACAACAGTGAGTTAAACCAATCAGCCTGTTTATCTKATATGTGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18868
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130347 Nonsense 148 648 5 19
ENSDART00000130347 Nonsense 148 648 5 19
Genomic Location (Zv9):
Chromosome 7 (position 20929159)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 19519595
GRCz11 7 19771563
KASP Assay ID:
2259-8646.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTGCAAAGTGCAGTGCCGTCCTTTCCTCTGCAAGCAGCCCAGTCACAAAC[C/T]AATCAACAACAGTGAGTTAAACCAATCAGCCTGTTTATCTTATATGTGAG
Associated Phenotype:
Not determined