Busch Lab

ZMP

ENSDARG00000089798

Ensembl ID:
ENSDARG00000089798

Alleles

There are 8 alleles of this gene:

Allele Name Consequence Status Availability
sa21173 Nonsense Available for shipment Available now
sa31626 Nonsense Available for shipment Available now
sa25383 Nonsense Mutation detected in F1 DNA Not yet available
sa25382 Nonsense Mutation detected in F1 DNA Not yet available
sa25381 Nonsense Mutation detected in F1 DNA Not yet available
sa34273 Nonsense Mutation detected in F1 DNA Not yet available
sa27122 Nonsense Mutation detected in F1 DNA Not yet available
sa25380 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa21173
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126402 Nonsense 82 604 2 2
Genomic Location (Zv9):
Chromosome 8 (position 1517663)
Other Location(s):
Assembly Chromosome Position
GRCz10 KN150336.1 17590
GRCz11 KN150336.1 17590
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTTGATTCCAGCTGTTCTTTGGGTGTTGCTTCCAGCTGTTGTTTGGGTTT[T/A]GCATTTAGTACTTGTTTTGGTGTTGCTTCCAGCTGTTGTTTGGGTGTTGC
Long Flanking Sequence:
CAGCTGTTGTTTGGGTTTTGCATTTAGTGCTTGTTTTGGTGTTGCTTCCAGCTGTTGTTTCAGTGTTGCTTCCAGCTGTTGTTTCAGTGTTGCTTCCAGCTGTTGTTTCAGTGCTCTTGTTTGGATGTTGCTTCTAGCTGTTGTTTTGGTGTTGCTTCCAAAAGTTGTTTGGATGTTGCTTCCAGCTGTTGTTTCAGTGTTGCTTCCAGCTGTTGTTTGGGTGTTCCTTTCAGCTGTTGTTTGGGTTTTGCTTTCGAGGTGTTGTTTGTGTGATGCTTCCAGCTGTTGTTTCAGTGTTGTTTCAGTGTTGCTTCCAGCTGTTGTTTGGGTGTTGCTTCCAGCTGTTGTTTAGGTGTTGCTTCCAGCTGTTGTTTCAGTGTTGCTTCCAGCTGTTGTTTGGGTGTTCATTCCAGCTGTTGTTTGGGTTTTGCATTTAGTGCTTGTTTTGGTGTTGATTCCAGCTGTTCTTTGGGTGTTGCTTCCAGCTGTTGTTTGGGTTT[T/A]GCATTTAGTACTTGTTTTGGTGTTGCTTCCAGCTGTTGTTTGGGTGTTGCCTCCAAAAGTTGTTTGGGTGTTGCTTCCAGCTGTTGTTTGGGTGTTGCCTCCAAAAGTTGTTTGGGTGTTGTATCCAGCTGTTGTTTCAGTGTTGCTTCCAGCTGTTGTTTCAGTGTTGCCTCCAAAAGTTGTTTGGGGGTTGCTTCCAGCTGTTGTTTGGGTGTTGCTTCCAGCTGTTGTTTGGGTGTTGCCTCCAGCAGTTGTTTCAGTGTTGCTTCCAGCTGTTGTATGGGTGCTGCTTCCAGCTGTTGTTTGGGTGTTGCTTCCAGCTGTTGTTTGGGTGTTGCTTCCAGCTGTTGTTTGGGTGTTTCTTCCAGCACTGTTGTTTCAGTGTTGCTTCCAGCTGTTGCCTCCAAAAGTTGTTTGGGTGTTGCTTCCAGCTGTTGTTTGGGTGTTGCTTTCAGCTGTTGTTTGGGTGTTCATTCCAGCTGTTGTTTGGGTGTTGCCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31626
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126402 Nonsense 233 604 2 2
Genomic Location (Zv9):
Chromosome 8 (position 1517210)
Other Location(s):
Assembly Chromosome Position
GRCz10 KN150336.1 17137
GRCz11 KN150336.1 17137
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCCAAAAGTTGTTTGGGTGTTGCTTCCAGCTGTTGTTTGGGTGTTGCTTT[C/A]AGCTGTTGTTTGGGTGTTCATTCCAGCTGTTGTTTGGGTGTTGCCTCCAA
Long Flanking Sequence:
GATTCCAGCTGTTCTTTGGGTGTTGCTTCCAGCTGTTGTTTGGGTTTTGCATTTAGTACTTGTTTTGGTGTTGCTTCCAGCTGTTGTTTGGGTGTTGCCTCCAAAAGTTGTTTGGGTGTTGCTTCCAGCTGTTGTTTGGGTGTTGCCTCCAAAAGTTGTTTGGGTGTTGTATCCAGCTGTTGTTTCAGTGTTGCTTCCAGCTGTTGTTTCAGTGTTGCCTCCAAAAGTTGTTTGGGGGTTGCTTCCAGCTGTTGTTTGGGTGTTGCTTCCAGCTGTTGTTTGGGTGTTGCCTCCAGCAGTTGTTTCAGTGTTGCTTCCAGCTGTTGTATGGGTGCTGCTTCCAGCTGTTGTTTGGGTGTTGCTTCCAGCTGTTGTTTGGGTGTTGCTTCCAGCTGTTGTTTGGGTGTTTCTTCCAGCACTGTTGTTTCAGTGTTGCTTCCAGCTGTTGCCTCCAAAAGTTGTTTGGGTGTTGCTTCCAGCTGTTGTTTGGGTGTTGCTTT[C/A]AGCTGTTGTTTGGGTGTTCATTCCAGCTGTTGTTTGGGTGTTGCCTCCAAAAGTTGTTTGGGTGTTGCTTCCAGCTGTTGTTTGTGTGTTGCTTCCAGCTGTTGTTTGGGTGTTTCTTCCAGCGCTGTTGTTTCAGTGTTGTTTCCAGCTGTTGTATGGGTGTTGCCTCCAGCTGTTGTTTCAGTGTTGCTTCCAGCTGTGGTTTCAGTGTTGCTTCCAGCTGTGGTTTCAGTGTTGCTTCCAGCTGTTGTTTCAGTGTTGCTTCCAGCTGTTGTTTCAGTGTTGCTTCCAGCTGTTGTTTCAGTGTTGCTTCCAGCTGTTGTTTGGGTGTTCCTTTCAGCTGTTGTTTGGGTGTTGCATTCAGTGCTTGTTTTGGTGTTGCTTCCAGCTGTGGTTTCAGTGTTGCTTCCAGCTGTTGTTTCAGTGTTGCTTCCAGCTGTTGTTTGGGTGTTCCTTTCAGCTGTTGTTTGGGTGTTCATTCCAGCTGTTGTTTGGGTGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25383
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126402 Nonsense 245 604 2 2
Genomic Location (Zv9):
Chromosome 8 (position 1517173)
Other Location(s):
Assembly Chromosome Position
GRCz10 KN150336.1 17100
GRCz11 KN150336.1 17100
KASP Assay ID:
554-7581.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGGGTGTTGCTTTCAGCTGTTGTTTGGGTGTTCATTCCAGCTGTTGTTTG[G/A]GTGTTGCCTCCAAAAGTTGTTTGGGTGTTGCTTCCAGCTGTTGTTTGTGT
Long Flanking Sequence:
GTTTGGGTTTTGCATTTAGTACTTGTTTTGGTGTTGCTTCCAGCTGTTGTTTGGGTGTTGCCTCCAAAAGTTGTTTGGGTGTTGCTTCCAGCTGTTGTTTGGGTGTTGCCTCCAAAAGTTGTTTGGGTGTTGTATCCAGCTGTTGTTTCAGTGTTGCTTCCAGCTGTTGTTTCAGTGTTGCCTCCAAAAGTTGTTTGGGGGTTGCTTCCAGCTGTTGTTTGGGTGTTGCTTCCAGCTGTTGTTTGGGTGTTGCCTCCAGCAGTTGTTTCAGTGTTGCTTCCAGCTGTTGTATGGGTGCTGCTTCCAGCTGTTGTTTGGGTGTTGCTTCCAGCTGTTGTTTGGGTGTTGCTTCCAGCTGTTGTTTGGGTGTTTCTTCCAGCACTGTTGTTTCAGTGTTGCTTCCAGCTGTTGCCTCCAAAAGTTGTTTGGGTGTTGCTTCCAGCTGTTGTTTGGGTGTTGCTTTCAGCTGTTGTTTGGGTGTTCATTCCAGCTGTTGTTTG[G/A]GTGTTGCCTCCAAAAGTTGTTTGGGTGTTGCTTCCAGCTGTTGTTTGTGTGTTGCTTCCAGCTGTTGTTTGGGTGTTTCTTCCAGCGCTGTTGTTTCAGTGTTGTTTCCAGCTGTTGTATGGGTGTTGCCTCCAGCTGTTGTTTCAGTGTTGCTTCCAGCTGTGGTTTCAGTGTTGCTTCCAGCTGTGGTTTCAGTGTTGCTTCCAGCTGTTGTTTCAGTGTTGCTTCCAGCTGTTGTTTCAGTGTTGCTTCCAGCTGTTGTTTCAGTGTTGCTTCCAGCTGTTGTTTGGGTGTTCCTTTCAGCTGTTGTTTGGGTGTTGCATTCAGTGCTTGTTTTGGTGTTGCTTCCAGCTGTGGTTTCAGTGTTGCTTCCAGCTGTTGTTTCAGTGTTGCTTCCAGCTGTTGTTTGGGTGTTCCTTTCAGCTGTTGTTTGGGTGTTCATTCCAGCTGTTGTTTGGGTGTTGCCTCCAAAAGTTGTTTGGGTTTTGCTTCCAGCTGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25382
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126402 Nonsense 253 604 2 2
Genomic Location (Zv9):
Chromosome 8 (position 1517149)
Other Location(s):
Assembly Chromosome Position
GRCz10 KN150336.1 17076
GRCz11 KN150336.1 17076
KASP Assay ID:
554-7856.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGGGTGTTCATTCCAGCTGTTGTTTGGGTGTTGCCTCCAAAAGTTGTTTG[G/A]GTGTTGCTTCCAGCTGTTGTTTGTGTGTTGCTTCCAGCTGTTGTTTGGGT
Long Flanking Sequence:
GTTTTGGTGTTGCTTCCAGCTGTTGTTTGGGTGTTGCCTCCAAAAGTTGTTTGGGTGTTGCTTCCAGCTGTTGTTTGGGTGTTGCCTCCAAAAGTTGTTTGGGTGTTGTATCCAGCTGTTGTTTCAGTGTTGCTTCCAGCTGTTGTTTCAGTGTTGCCTCCAAAAGTTGTTTGGGGGTTGCTTCCAGCTGTTGTTTGGGTGTTGCTTCCAGCTGTTGTTTGGGTGTTGCCTCCAGCAGTTGTTTCAGTGTTGCTTCCAGCTGTTGTATGGGTGCTGCTTCCAGCTGTTGTTTGGGTGTTGCTTCCAGCTGTTGTTTGGGTGTTGCTTCCAGCTGTTGTTTGGGTGTTTCTTCCAGCACTGTTGTTTCAGTGTTGCTTCCAGCTGTTGCCTCCAAAAGTTGTTTGGGTGTTGCTTCCAGCTGTTGTTTGGGTGTTGCTTTCAGCTGTTGTTTGGGTGTTCATTCCAGCTGTTGTTTGGGTGTTGCCTCCAAAAGTTGTTTG[G/A]GTGTTGCTTCCAGCTGTTGTTTGTGTGTTGCTTCCAGCTGTTGTTTGGGTGTTTCTTCCAGCGCTGTTGTTTCAGTGTTGTTTCCAGCTGTTGTATGGGTGTTGCCTCCAGCTGTTGTTTCAGTGTTGCTTCCAGCTGTGGTTTCAGTGTTGCTTCCAGCTGTGGTTTCAGTGTTGCTTCCAGCTGTTGTTTCAGTGTTGCTTCCAGCTGTTGTTTCAGTGTTGCTTCCAGCTGTTGTTTCAGTGTTGCTTCCAGCTGTTGTTTGGGTGTTCCTTTCAGCTGTTGTTTGGGTGTTGCATTCAGTGCTTGTTTTGGTGTTGCTTCCAGCTGTGGTTTCAGTGTTGCTTCCAGCTGTTGTTTCAGTGTTGCTTCCAGCTGTTGTTTGGGTGTTCCTTTCAGCTGTTGTTTGGGTGTTCATTCCAGCTGTTGTTTGGGTGTTGCCTCCAAAAGTTGTTTGGGTTTTGCTTCCAGCTGTTGTTTGTGTGTTGCTTCCAGCTGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25381
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126402 Nonsense 302 604 2 2
Genomic Location (Zv9):
Chromosome 8 (position 1517004)
Other Location(s):
Assembly Chromosome Position
GRCz10 KN150336.1 16931
GRCz11 KN150336.1 16931
KASP Assay ID:
554-7845.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATGGGTGTTGCCTCCAGCTGTTGTTTCAGTGTTGCTTCCAGCTGTGGTTT[C/T]AGTGTTGCTTCCAGCTGTGGTTTCAGTGTTGCTTCCAGCTGTTGTTTCAG
Long Flanking Sequence:
TTTCAGTGTTGCCTCCAAAAGTTGTTTGGGGGTTGCTTCCAGCTGTTGTTTGGGTGTTGCTTCCAGCTGTTGTTTGGGTGTTGCCTCCAGCAGTTGTTTCAGTGTTGCTTCCAGCTGTTGTATGGGTGCTGCTTCCAGCTGTTGTTTGGGTGTTGCTTCCAGCTGTTGTTTGGGTGTTGCTTCCAGCTGTTGTTTGGGTGTTTCTTCCAGCACTGTTGTTTCAGTGTTGCTTCCAGCTGTTGCCTCCAAAAGTTGTTTGGGTGTTGCTTCCAGCTGTTGTTTGGGTGTTGCTTTCAGCTGTTGTTTGGGTGTTCATTCCAGCTGTTGTTTGGGTGTTGCCTCCAAAAGTTGTTTGGGTGTTGCTTCCAGCTGTTGTTTGTGTGTTGCTTCCAGCTGTTGTTTGGGTGTTTCTTCCAGCGCTGTTGTTTCAGTGTTGTTTCCAGCTGTTGTATGGGTGTTGCCTCCAGCTGTTGTTTCAGTGTTGCTTCCAGCTGTGGTTT[C/T]AGTGTTGCTTCCAGCTGTGGTTTCAGTGTTGCTTCCAGCTGTTGTTTCAGTGTTGCTTCCAGCTGTTGTTTCAGTGTTGCTTCCAGCTGTTGTTTCAGTGTTGCTTCCAGCTGTTGTTTGGGTGTTCCTTTCAGCTGTTGTTTGGGTGTTGCATTCAGTGCTTGTTTTGGTGTTGCTTCCAGCTGTGGTTTCAGTGTTGCTTCCAGCTGTTGTTTCAGTGTTGCTTCCAGCTGTTGTTTGGGTGTTCCTTTCAGCTGTTGTTTGGGTGTTCATTCCAGCTGTTGTTTGGGTGTTGCCTCCAAAAGTTGTTTGGGTTTTGCTTCCAGCTGTTGTTTGTGTGTTGCTTCCAGCTGTTGTTTGGGTGTTTCTTCCAGCGCTGTTGTTTCAGTGTTGTTTCCAGCTGTTGTATGGGTGTTGCCTCCAGCTGTTGTTTCAGTGTTGCTTCCAGCTGTGGTTTCAGTGTTGCTTCCAGCTGTGGTTTCAGTGTTGCTTCCAGCTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34273
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126402 Nonsense 372 604 2 2
Genomic Location (Zv9):
Chromosome 8 (position 1516793)
Other Location(s):
Assembly Chromosome Position
GRCz10 KN150336.1 16720
GRCz11 KN150336.1 16720
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTTGTTTTGGTGTTGCTTCCAGCTGTGGTTTCAGTGTTGCTTCCAGCTGT[T/A]GTTTCAGTGTTGCTTCCAGCTGTTGTTTGGGTGTTCCTTTCAGCTGTTGT
Long Flanking Sequence:
ACTGTTGTTTCAGTGTTGCTTCCAGCTGTTGCCTCCAAAAGTTGTTTGGGTGTTGCTTCCAGCTGTTGTTTGGGTGTTGCTTTCAGCTGTTGTTTGGGTGTTCATTCCAGCTGTTGTTTGGGTGTTGCCTCCAAAAGTTGTTTGGGTGTTGCTTCCAGCTGTTGTTTGTGTGTTGCTTCCAGCTGTTGTTTGGGTGTTTCTTCCAGCGCTGTTGTTTCAGTGTTGTTTCCAGCTGTTGTATGGGTGTTGCCTCCAGCTGTTGTTTCAGTGTTGCTTCCAGCTGTGGTTTCAGTGTTGCTTCCAGCTGTGGTTTCAGTGTTGCTTCCAGCTGTTGTTTCAGTGTTGCTTCCAGCTGTTGTTTCAGTGTTGCTTCCAGCTGTTGTTTCAGTGTTGCTTCCAGCTGTTGTTTGGGTGTTCCTTTCAGCTGTTGTTTGGGTGTTGCATTCAGTGCTTGTTTTGGTGTTGCTTCCAGCTGTGGTTTCAGTGTTGCTTCCAGCTGT[T/A]GTTTCAGTGTTGCTTCCAGCTGTTGTTTGGGTGTTCCTTTCAGCTGTTGTTTGGGTGTTCATTCCAGCTGTTGTTTGGGTGTTGCCTCCAAAAGTTGTTTGGGTTTTGCTTCCAGCTGTTGTTTGTGTGTTGCTTCCAGCTGTTGTTTGGGTGTTTCTTCCAGCGCTGTTGTTTCAGTGTTGTTTCCAGCTGTTGTATGGGTGTTGCCTCCAGCTGTTGTTTCAGTGTTGCTTCCAGCTGTGGTTTCAGTGTTGCTTCCAGCTGTGGTTTCAGTGTTGCTTCCAGCTGTTGTTTCAGTGTTGCTTCCAGCTGTGGTTTCAGTGTTGCTTCCAGCTGTTGTTTCAGTGTTGCTTCCAGCTGTTGTTTCAGTGTTGCTTCCAGCTGTTGTTTGGGTGTTCCTTTCAGCTGTTGTTTGGGTGTTGCATTCAGTGCTTGTTTTGGTGTTGCTTCCAGCTGTGGTTTTAGTGTTGCTTCCAGCTGTTGTTTCAGTGTTGCTTCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa27122
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126402 Nonsense 394 604 2 2
Genomic Location (Zv9):
Chromosome 8 (position 1516728)
Other Location(s):
Assembly Chromosome Position
GRCz10 KN150336.1 16655
GRCz11 KN150336.1 16655
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCCAGCTGTTGTTTGGGTGTTCCTTTCAGCTGTTGTTTGGGTGTTCATTC[C/T]AGCTGTTGTTTGGGTGTTGCCTCCAAAAGTTGTTTGGGTTTTGCTTCCAG
Long Flanking Sequence:
TTGTTTGGGTGTTGCTTTCAGCTGTTGTTTGGGTGTTCATTCCAGCTGTTGTTTGGGTGTTGCCTCCAAAAGTTGTTTGGGTGTTGCTTCCAGCTGTTGTTTGTGTGTTGCTTCCAGCTGTTGTTTGGGTGTTTCTTCCAGCGCTGTTGTTTCAGTGTTGTTTCCAGCTGTTGTATGGGTGTTGCCTCCAGCTGTTGTTTCAGTGTTGCTTCCAGCTGTGGTTTCAGTGTTGCTTCCAGCTGTGGTTTCAGTGTTGCTTCCAGCTGTTGTTTCAGTGTTGCTTCCAGCTGTTGTTTCAGTGTTGCTTCCAGCTGTTGTTTCAGTGTTGCTTCCAGCTGTTGTTTGGGTGTTCCTTTCAGCTGTTGTTTGGGTGTTGCATTCAGTGCTTGTTTTGGTGTTGCTTCCAGCTGTGGTTTCAGTGTTGCTTCCAGCTGTTGTTTCAGTGTTGCTTCCAGCTGTTGTTTGGGTGTTCCTTTCAGCTGTTGTTTGGGTGTTCATTC[C/T]AGCTGTTGTTTGGGTGTTGCCTCCAAAAGTTGTTTGGGTTTTGCTTCCAGCTGTTGTTTGTGTGTTGCTTCCAGCTGTTGTTTGGGTGTTTCTTCCAGCGCTGTTGTTTCAGTGTTGTTTCCAGCTGTTGTATGGGTGTTGCCTCCAGCTGTTGTTTCAGTGTTGCTTCCAGCTGTGGTTTCAGTGTTGCTTCCAGCTGTGGTTTCAGTGTTGCTTCCAGCTGTTGTTTCAGTGTTGCTTCCAGCTGTGGTTTCAGTGTTGCTTCCAGCTGTTGTTTCAGTGTTGCTTCCAGCTGTTGTTTCAGTGTTGCTTCCAGCTGTTGTTTGGGTGTTCCTTTCAGCTGTTGTTTGGGTGTTGCATTCAGTGCTTGTTTTGGTGTTGCTTCCAGCTGTGGTTTTAGTGTTGCTTCCAGCTGTTGTTTCAGTGTTGCTTCCAGCTGTTGTTTGGGTGTTCCTTTCAGCTGTTGTTTGGGTGTTGCATTCAGTGCTTGTTTTGGTGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25380
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126402 Nonsense 408 604 2 2
Genomic Location (Zv9):
Chromosome 8 (position 1516684)
Other Location(s):
Assembly Chromosome Position
GRCz10 KN150336.1 16611
GRCz11 KN150336.1 16611
KASP Assay ID:
554-7834.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCATTCCAGCTGTTGTTTGGGTGTTGCCTCCAAAAGTTGTTTGGGTTTTG[C/A]TTCCAGCTGTTGTTTGTGTGTTGCTTCCAGCTGTTGTTTGGGTGTTTCTT
Long Flanking Sequence:
GCTGTTGTTTGGGTGTTGCCTCCAAAAGTTGTTTGGGTGTTGCTTCCAGCTGTTGTTTGTGTGTTGCTTCCAGCTGTTGTTTGGGTGTTTCTTCCAGCGCTGTTGTTTCAGTGTTGTTTCCAGCTGTTGTATGGGTGTTGCCTCCAGCTGTTGTTTCAGTGTTGCTTCCAGCTGTGGTTTCAGTGTTGCTTCCAGCTGTGGTTTCAGTGTTGCTTCCAGCTGTTGTTTCAGTGTTGCTTCCAGCTGTTGTTTCAGTGTTGCTTCCAGCTGTTGTTTCAGTGTTGCTTCCAGCTGTTGTTTGGGTGTTCCTTTCAGCTGTTGTTTGGGTGTTGCATTCAGTGCTTGTTTTGGTGTTGCTTCCAGCTGTGGTTTCAGTGTTGCTTCCAGCTGTTGTTTCAGTGTTGCTTCCAGCTGTTGTTTGGGTGTTCCTTTCAGCTGTTGTTTGGGTGTTCATTCCAGCTGTTGTTTGGGTGTTGCCTCCAAAAGTTGTTTGGGTTTTG[C/A]TTCCAGCTGTTGTTTGTGTGTTGCTTCCAGCTGTTGTTTGGGTGTTTCTTCCAGCGCTGTTGTTTCAGTGTTGTTTCCAGCTGTTGTATGGGTGTTGCCTCCAGCTGTTGTTTCAGTGTTGCTTCCAGCTGTGGTTTCAGTGTTGCTTCCAGCTGTGGTTTCAGTGTTGCTTCCAGCTGTTGTTTCAGTGTTGCTTCCAGCTGTGGTTTCAGTGTTGCTTCCAGCTGTTGTTTCAGTGTTGCTTCCAGCTGTTGTTTCAGTGTTGCTTCCAGCTGTTGTTTGGGTGTTCCTTTCAGCTGTTGTTTGGGTGTTGCATTCAGTGCTTGTTTTGGTGTTGCTTCCAGCTGTGGTTTTAGTGTTGCTTCCAGCTGTTGTTTCAGTGTTGCTTCCAGCTGTTGTTTGGGTGTTCCTTTCAGCTGTTGTTTGGGTGTTGCATTCAGTGCTTGTTTTGGTGTTGCTTCCAGCTGTTGTTTGGGTGTTGCTTTGAGGTGTTGTTTATG
Associated Phenotype:
Not determined