Busch Lab

ZMP

ENSDARG00000089762

Ensembl ID:
ENSDARG00000089762

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa32632 Nonsense Mutation detected in F1 DNA Not yet available
sa32631 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa39575 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa32632
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122532 Nonsense 246 536 1 3
Genomic Location (Zv9):
Chromosome 1 (position 14218694)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 14805480
GRCz11 1 15491993
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATAAACCTCCCACTTCTGATTCATCTGCTGACCCGTGTGATAATGAGGAA[G/T]GACATTGTTGTGAAACATCTGAACAGGCAATTTTAAAATGTATTAAAACT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa25548
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122532 Nonsense 320 536 1 3
Genomic Location (Zv9):
Chromosome 1 (position 14218472)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 14805258
GRCz11 1 15491771
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAAATGGAGATGGTATTTTTAAGTGTGCTGATGGTGATACGTTAAACGTT[G/T]GATGCATTAACCCACATGCTTGTGAAAGTTCTCAACTGAAAGAATGTGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32631
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122532 Essential Splice Site 437 536 1 3
Genomic Location (Zv9):
Chromosome 1 (position 14218117)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 14804903
GRCz11 1 15491416
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GATGGTCCCCAAAGCTGATGGTAGCATTGTCAAGCTTCGCACAAGAAAGG[T/A]AAGTAGTTTTAGGTTATTTTTTTTATGAGTAAACAATAGCTGTTTTAATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39575
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122532 Essential Splice Site 438 536 2 3
Genomic Location (Zv9):
Chromosome 1 (position 14186415)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 14773201
GRCz11 1 15459714
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTCTGGTTTTAAGATTAGATTACTTGAATAAAATCTGTTTTTCTCCTTTC[A/T]GAGCTCACATGAAGAGAGGGAGAAGGAGAGGTCCCGGCTGGACTCAATGG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa7900
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122532 Nonsense 522 536 3 3
Genomic Location (Zv9):
Chromosome 1 (position 14185498)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 14772284
GRCz11 1 15458797
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGTCTCTAAACACCCCACTTTATCGCTCTTCTTCATCGTTGTCTTCATCA[G/T]GACCCACCGGAACCCCTGGAGCRAGACCAAAAAATGAGGTCAGTTAACAA
Associated Phenotype:
Not determined