Busch Lab

ZMP

zgc:153235

Ensembl ID:
ENSDARG00000089641
ZFIN ID:
ZDB-GENE-060929-136
Description:
hypothetical protein LOC767640 [Source:RefSeq peptide;Acc:NP_001070048]
Human Orthologue:
PPM1L
Human Description:
protein phosphatase, Mg2+/Mn2+ dependent, 1L [Source:HGNC Symbol;Acc:16381]
Mouse Orthologue:
Ppm1l
Mouse Description:
protein phosphatase 1 (formerly 2C)-like Gene [Source:MGI Symbol;Acc:MGI:2139740]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa32010 Nonsense Available for shipment Available now
sa35785 Nonsense Mutation detected in F1 DNA Not yet available
sa22570 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa32010
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127396 Nonsense 159 348 2 4
Genomic Location (Zv9):
Chromosome 15 (position 1630323)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 1670208
GRCz11 15 1635117
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCTACGAGCGGCAGAAGGAGAACAGCGCGGTCAGCCGGCAGGCCATCCTC[C/T]GACAGCAGATCCTCAACATGGACCGAGAGATTCTGGAGAAACTGACGGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35785
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127396 Nonsense 160 348 2 4
Genomic Location (Zv9):
Chromosome 15 (position 1630320)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 1670205
GRCz11 15 1635114
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACGAGCGGCAGAAGGAGAACAGCGCGGTCAGCCGGCAGGCCATCCTCCGA[C/T]AGCAGATCCTCAACATGGACCGAGAGATTCTGGAGAAACTGACGGCATCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22570
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127396 Nonsense 177 348 2 4
Genomic Location (Zv9):
Chromosome 15 (position 1630267)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 1670152
GRCz11 15 1635061
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAGATCCTCAACATGGACCGAGAGATTCTGGAGAAACTGACGGCATCCTA[T/A]GATGAAGCAGGTGAGAGCTCAGCGCAGGGGCAGAGCAAAGATTTGATATG
Associated Phenotype:
Not determined