Busch Lab

ZMP

pbx1a

Ensembl ID:
ENSDARG00000089610
ZFIN ID:
ZDB-GENE-000405-1
Description:
pre-B-cell leukemia transcription factor 1a (pbx1a), transcript variant 1, mRNA [Source:RefSeq DNA;A
Human Orthologue:
PBX1
Human Description:
pre-B-cell leukemia homeobox 1 [Source:HGNC Symbol;Acc:8632]
Mouse Orthologue:
Pbx1
Mouse Description:
pre B-cell leukemia transcription factor 1 Gene [Source:MGI Symbol;Acc:MGI:97495]

Alleles

There are 6 alleles of this gene:

Allele Name Consequence Status Availability
sa12947 Essential Splice Site Available for shipment Available now
sa15504 Nonsense Available for shipment Available now
sa17065 Essential Splice Site Available for shipment Available now
sa6831 Missense, Nonsense Mutation detected in F1 DNA Not yet available
sa32888 Missense, Nonsense Mutation detected in F1 DNA Not yet available
sa31272 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa12947
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003750 None 48 260 1 5
ENSDART00000038419 Essential Splice Site 39 337 2 9
ENSDART00000073947 None 48 342 1 7
Genomic Location (Zv9):
Chromosome 2 (position 19717702)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 19085713
GRCz11 2 18734981
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GGYCCTGAGAAAGGGGGCGGGTCTGCTGCTGCTGCAGCTGCTGCTGCTGC[G/A]GCAGGCGGYGTCGGCTCCGATAACTCCGCCGAACACTCAGACTACAGGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15504
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003750 Nonsense 209 260 4 5
ENSDART00000038419 Nonsense 200 337 6 9
ENSDART00000073947 Nonsense 209 342 4 7
Genomic Location (Zv9):
Chromosome 2 (position 19729939)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 19073476
GRCz11 2 18722744
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGGTATCCAAYTGGTTTGGAAACAAAAGGATCAGATACAAGAAAAATATT[G/T]GAAAATTCCAAGAAGAAGCCAACATGTACGCTGCCRGAACCGCCGCTAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17065
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003750 Essential Splice Site 246 260 None 5
ENSDART00000038419 Essential Splice Site 275 337 None 9
ENSDART00000073947 Essential Splice Site 283 342 None 7
Genomic Location (Zv9):
Chromosome 2 (position 19738109)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 19065306
GRCz11 2 18714574
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ACAGACRTCTTTGTTTTGAACGCTTTTGTGTGTTGTGTTCCGGTGTCTGC[A/T]GGTGGATACTCTTCGCCATGTTAWCAGTCAGACAGGAGGATACAGTGAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6831
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Missense, Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003750 Nonsense 253 260 5 5
ENSDART00000038419 Missense 282 337 8 9
ENSDART00000073947 Missense 290 342 6 7
Genomic Location (Zv9):
Chromosome 2 (position 19738133)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 19065282
GRCz11 2 18714550
KASP Assay ID:
554-5116.1 (used for ordering genotyping assays)
KASP Sequence:
TTTGTGTGTTGTGTTCCGGTGTCTGCAGGTGGATACTCTTCGCCATGTTA[T/A]CAGTCAGACAGGAGGATACAGTGAAAGCCTYGCTGCCAGTCAGATATACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32888
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Missense, Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003750 Nonsense 255 260 5 5
ENSDART00000038419 Missense 284 337 8 9
ENSDART00000073947 Missense 292 342 6 7
Genomic Location (Zv9):
Chromosome 2 (position 19738138)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 19065277
GRCz11 2 18714545
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTGTTGTGTTCCGGTGTCTGCAGGTGGATACTCTTCGCCATGTTATCAGT[C/A]AGACAGGAGGATACAGTGAAAGCCTTGCTGCCAGTCAGATATACAGTCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31272
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003750 None None 260 None 5
ENSDART00000038419 Essential Splice Site 304 337 8 9
ENSDART00000073947 Essential Splice Site 312 342 6 7
Genomic Location (Zv9):
Chromosome 2 (position 19738202)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 19065213
GRCz11 2 18714481
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAGTGAAAGCCTTGCTGCCAGTCAGATATACAGTCCACAGGGCATCAATG[T/C]AAGTCCGCACTCTCTGTTTTTCAAGCTTGTACCTGATTCTGCTGTTGTCT
Associated Phenotype:
Not determined