Busch Lab

ZMP

plce1

Ensembl ID:
ENSDARG00000089601
ZFIN ID:
ZDB-GENE-061212-4
Description:
1-phosphatidylinositol-4,5-bisphosphate phosphodiesterase epsilon-1 [Source:RefSeq peptide;Acc:NP_0
Human Orthologue:
PLCE1
Human Description:
phospholipase C, epsilon 1 [Source:HGNC Symbol;Acc:17175]
Mouse Orthologue:
Plce1
Mouse Description:
phospholipase C, epsilon 1 Gene [Source:MGI Symbol;Acc:MGI:1921305]

Alleles

There are 6 alleles of this gene:

Allele Name Consequence Status Availability
sa22015 Nonsense Available for shipment Available now
sa14377 Essential Splice Site Available for shipment Available now
sa41951 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa27871 Nonsense Mutation detected in F1 DNA Not yet available
sa41950 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa22015
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125067 Nonsense 56 1193 1 12
Genomic Location (Zv9):
Chromosome 12 (position 5606183)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 5216855
GRCz11 12 5251812
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAGATGCTCGTTTATTAATGAACTACAGTTTGCCTGGGGGCACACCCCCT[C/T]AGACACCAGTACATTTGGAGGGGGACTCAGTGGGCACAGTGTGCAGAATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14377
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125067 Essential Splice Site 446 1193 2 12
Genomic Location (Zv9):
Chromosome 12 (position 5550197)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 5272841
GRCz11 12 5307798
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTCYCTGCCCRGCTTCACTGTTGGCTCCACAGGACGAGCAATGCTGAAAG[G/A]TAAAGAAATGTACYACTTTTCTGTCTAAMTGCTGCTTTAAAATTKAACAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41951
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125067 Essential Splice Site 687 1193 5 12
Genomic Location (Zv9):
Chromosome 12 (position 5512741)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 5310297
GRCz11 12 5345254
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CATTATTGGACTGCGTCCGTCTTTTGATTCTCAAGAAGATCCTGTTGAGG[T/C]GAGGCACTTCTATGAAGTGATTATGGCTAATGCAGGAAATTATATCACCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa27871
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125067 Nonsense 764 1193 7 12
Genomic Location (Zv9):
Chromosome 12 (position 5508748)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 5314290
GRCz11 12 5349247
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTACCTTCTATCCTTAATGTCCACTCTGAAGGAAAGGACCTGGGACTGAA[C/T]GAGTCCTGTAAGTTGCCAGAAAGATCTGTTTTAAAGCACTTAATGGATTG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4450
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125067 Nonsense 984 1193 8 12
Genomic Location (Zv9):
Chromosome 12 (position 5504669)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 5318369
GRCz11 12 5353326
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTAGGAAGATCAGGAAATTCCCTGACCAGAGACTGCAATGGCTGAGAAAG[C/T]AATATGTTAGTTTGTACCAGGTATGTTCACACTTCACATCTGTTAATTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41950
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125067 Essential Splice Site 1052 1193 9 12
Genomic Location (Zv9):
Chromosome 12 (position 5500685)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 5322353
GRCz11 12 5357310
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CACTGGGCATCAACTCCAATGTCAAAAAAAAGAAAAAGGCCTTAGTCAGG[G/A]TGAGTAGAGAAGCACCGCGAGGCAACAGTGTGTTTTTTTTTTTTCTCGCT
Associated Phenotype:
Not determined