Busch Lab

ZMP

ENSDARG00000089596

Ensembl ID:
ENSDARG00000089596

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa11091 Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa28545
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126102 Nonsense 135 424 3 7
Genomic Location (Zv9):
Chromosome 15 (position 44084053)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 45065491
GRCz11 15 45196201
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTGGAGATCATGAGGCTCTGCAGCGATGCGTTCAGATCATCCGGGAGCGA[C/T]AGGCCGAGTTCAGCGAGCTGGAGAACACACGCACAAAACTCATGTATGTC
Long Flanking Sequence:
ATGTAAATATGTGTATATTTGTGAAATTTAGCACAAATATAGCCAATTAAAATGGAAAAAATAATAATTCTGGAAAATATTACTTTGAAAATGCTAATCTATTAATGTTTGTAATTAATTTTAGGTTTTTGTTTTCTATTTTTTTTTCTTTTTAGTTTGTGTTTTATTATTATTTTTGTTAAAACAAAATAATTGAAATATGGAAATAATGCCAACATTAAAACTAAAACTTAAATAAATACAAACTAATTAATAATACACTAATTACAGAAAGAAGTTGTTAAACAGCAGTTTTGTGTGTATTTGGCAATAGTTTTGATCTGTAAATCGTCTCTCAGGTGGAGGTGATGAAGGGGAACGTGGAGTCTCGTGTTCAGGTTTACCAGCAGGACCTGCAGAAGTTTAGAGCGCGCTGGGATCAGCTCAAACCCGGAAATGACATCATCGAGTCTGGAGATCATGAGGCTCTGCAGCGATGCGTTCAGATCATCCGGGAGCGA[C/T]AGGCCGAGTTCAGCGAGCTGGAGAACACACGCACAAAACTCATGTATGTCTCGATTATTCTTCATTATTTAAATGAAACTATATAATTAATACATTTTTACTATTAGAGGCTGGATATATTCACACACTGTTGCCACAAAATGGTGTGTAAACCCCTTATAAAAGTGATTTTCACATTTCAAAAATAATATAGTTCTAAAAATCATTGAAAAAACTAGTCTGTGCTGATAGAGTGATTAGAGAGCACAACAGCGCAGTCCCGGAGTACGAAACCAGGCTCATGGACCTTTCCTGATCCTTTCCACACTCTCTCTTTCTTCATTTACTTTCATTTATTGTCATGTCAAATAAAAGTAAATAAGCCACAGAATCTATAATAAATATATAATTTAATAGGGGTGGCGTAGTGGGTAGCACTTTCACCTTACAGCAAGAAGGTTGCTGGTTCGAGCCTAGACTGGGTCAGTTGGCATTTCTGTGTGGAGTTTGCATGTTCTCCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11091
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126102 Nonsense 249 424 6 7
Genomic Location (Zv9):
Chromosome 15 (position 44077014)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 45058452
GRCz11 15 45189162
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ACTAGTGTGTGTGTGTGNNTNNNNTTTAGGCGGTGGTWCCAGTGCTAAAGTACGTT[C/T]GAGGTGAGCATCTCTCTCAGGAACACTGGCTGGATCTGTTCCGGCTCATT
Long Flanking Sequence:
TTAAATTGCCTCTTTTTATAGTAATGTAATTGTTTGGTAACAAACAGGAAATGTTCATGGGCCAATGACTTCACCACATTGAAATGGTCTATAGTGTGTCTGATGGCTTGTGTTCATGTCTTCTGGAGTGTTTAGCTAAAATTAGTGATGTGTTTTTGTATTGCACTTTTAAACATTAGTTGCGTCCCAATTGTCACACTGTGCACTTATGTACACAACTGTGTAGTGTAAGAGTTGTGTTATCCCTAATTAAAGACTGAAGTTTAAAGTTGCCTAATTACCCTAGTGAAGCCTTTTAATGTCACTTTAAGCTGAATACTAGTATCTTGAAAAATATCTAGTCAAATATTATGTGCTGTCATCATGGCAAAGATAAAAAGAATCATTTGAATAACCATTGTGTATGAAATGTGTTATATAAATACCCTTGCCTTGCTACAATTGACAAAAACTAGTGTGTGTGTGTGTTTTAGGCGGTGGTTCCAGTGCTAAAGTACGTT[C/T]GAGGTGAGCATCTCTCTCAGGAACACTGGCTGGATCTGTTCCGGCTCATTTCTCTGCCCAGGGGATCCACACTGGAGACACTTCAGTTCAGAGACCTGCTCAGGGTGGCAGACAACATCATAGACAAAACCCTGGAGCTCAAGGTTCACACACACTTTTAACTTTCTGTACACTTTCCATCTGTTCACAGATAAACTCTTATTCTCCTCAGGTTTCAGTCCTCGTGAGTCAAAGATGCTGCACAATGTGAGACTTATGAGTAGTTATGAGGAACTCAAGACCTTGCACCAATTAGATTTCACTGTGGGCGTGACTAGTCAGCAGAGTTTATTGTGAAAACTTTAACCGCTAAATCCATTAAAGGGCCATGAAACCCCCTCGTTTCAGCAGGGTGTTTTCACACCTCTACTTTGGAAAAAGTCAGAAAAGTGGGCGTTCCAGCTCTGTTTAGGGGGGAGTGTCGGAGGAAGAAAAGTGGGATGTTGTGGGAGTGTCTATTT
Associated Phenotype:
Not determined