Busch Lab

ZMP

ENSDARG00000089577

Ensembl ID:
ENSDARG00000089577

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa38183 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa24799 Essential Splice Site Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa30472
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127315 Essential Splice Site 40 375 1 5
Genomic Location (Zv9):
Chromosome Zv9_NA331 (position 97722)
Other Location(s):
Assembly Chromosome Position
GRCz10 KN150030.1 43851
GRCz11 KN150030.1 43851
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGGATCAATGACCTTTAACCCAAGATTGGGCACTAATGGCTCGTACGAGG[T/G]GAGAACTATAAAGCTTTAAATGGATATACTTCTTGGATATACAGTTGAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38183
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127315 Essential Splice Site 152 375 3 5
Genomic Location (Zv9):
Chromosome Zv9_NA331 (position 106144)
Other Location(s):
Assembly Chromosome Position
GRCz10 KN150030.1 52273
GRCz11 KN150030.1 52273
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACTTTAGTGCCTAACAGATCCCCAATCTCTACCACTCTACCACTTCTTAG[G/A]TAAAAACTGCATTCTAGATGTGCATTCAACATGATGTAGGAATATAAATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24799
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127315 Essential Splice Site 152 375 4 5
Genomic Location (Zv9):
Chromosome Zv9_NA331 (position 106226)
Other Location(s):
Assembly Chromosome Position
GRCz10 KN150030.1 52355
GRCz11 KN150030.1 52355
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGATGTAGGAATATAAATGTACATGACATTGGCACTTTGTTTGTGTTGCA[G/A]AGTTCCTCAAAACTGTGCCAGGAGGTACAACCTTTTAGCCTTTGATCCAG
Associated Phenotype:
Not determined