Busch Lab

ZMP

zgc:158824

Ensembl ID:
ENSDARG00000089550
ZFIN IDs:
ZDB-GENE-000405-1, ZDB-GENE-000405-1, ZDB-GENE-070424-11, ZDB-GENE-070424-11
Description:
pre-B-cell leukemia homeobox 1 [Source:RefSeq peptide;Acc:NP_001077322]
Human Orthologue:
PBX1
Human Description:
pre-B-cell leukemia homeobox 1 [Source:HGNC Symbol;Acc:8632]
Mouse Orthologue:
Pbx1
Mouse Description:
pre B-cell leukemia transcription factor 1 Gene [Source:MGI Symbol;Acc:MGI:97495]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa15193 Essential Splice Site Available for shipment Available now
sa26652 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa26651
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122028 Essential Splice Site None 275 1 9
ENSDART00000125538 Essential Splice Site 63 429 1 10
ENSDART00000129503 Essential Splice Site 63 429 1 9
Genomic Location (Zv9):
Chromosome 6 (position 2064642)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 2294389
GRCz11 6 2271780
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAACAGATCATGACCATCACTGACCAGAGTCTGGACGAGGCGCAGGCCAG[G/A]TGAGCTGTCAATCAGCACATTACAAAATACACTGACTTTCATCCTCATTG
Long Flanking Sequence:
GCTACACGCTTCATACGTCCAATCAGAGCGCGTAGGCGGGGTCTGTGCATCGCAGAGTCTCTGCGAGCGCTACAGTGTAACAAAAGCAGCGGGATGAAAGAGTGAAATAACGCGCGAGTGTATGAAGCGCTGCGTTCATTAATAACACTCACCGCACACACACACACACACACATACACTCACTCTGTCTAGCACTCATTCTCACTCTGCGCTCACAGGACTTCATACACACACACACACACATACACAGAGGAGCTGAGGAATCTCCGCCGCAGCTGGACAGCAGAGTACGGAGCACCAGAGCGGGCCGACATGGACGAGCAGCCGCGCCTGATGCACGCACATGCGGCCGTGGGGATGAGCGGACACCCGGGCCTGGCTCCGCACATACCGGACAACACCGGAGCCGCCGACGGGGACGGAAGAAAGCAGGACATTGGAGACATTTTACAACAGATCATGACCATCACTGACCAGAGTCTGGACGAGGCGCAGGCCAG[G/A]TGAGCTGTCAATCAGCACATTACAAAATACACTGACTTTCATCCTCATTGACATTTGATCGACTGCTCTTTCAAAAGCAATGCACTTTTAACAGACCATAATCATTTTAAAACACAATTAGAGTAGACAAATGATCTAATAGGACATTTAATGCATATTTGATTTAAACGAGTTAGTAGTAATGGTTTGAAATGCAATGCACTTTTAACAAACAACAATAATAATCATTTTAAAACATATATAGAGTACGCAAATACCTAATAGCACATTTATATAATGCATATATATTATGAACGAGTTACTTTGAAATACAATGCACTTTTAACAGACAATAATAATAATTTTAAAACATATATAGAGTAGACAAACATCTAATAGGACATTTAATGCATGTTTAATATGGACCAGCTTGTGGTAGTAATTAGAAATGCAATGCACTTCCAACATACAAAAATAATAATACTTTTAAACATATATAATTTAAAAAATGTCTAATAGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15193
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122028 Essential Splice Site 17 275 3 9
ENSDART00000125538 Essential Splice Site 88 429 3 10
ENSDART00000129503 Essential Splice Site 88 429 3 9
Genomic Location (Zv9):
Chromosome 6 (position 2168031)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 2193527
GRCz11 6 2371896
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGGGATRTTGGAGCWGTGTCAGTAATCTTYCTCTGTTTGCTTTGTGTTTT[A/C]GTGTTGAGTATCCGTGGAGCTCAGGAGGAGGAGCCTCCCGACGCTCAGCT
Long Flanking Sequence:
TGTGCTTTTTTTAAAAAAAAGAAAAAGTATATAGTGGGTGTGTGTGTACTTGTTTTTATACACCAGTGGGGACTTAAACATGAATACACACAAACTCATGGGGACGTGTGTCAACTTTGGGTGTGTATGTGTGCATGTGTGTGTAGTGTAAGTGTAGGTGTTTGTATGCAAGTGTGTTTTACCACTACAGATCTGGTGTAAACTCAGTCACTGAGTCCCTCTAGTGTGGGATCTTCAGAGCGCAGGGATCACTGTGAGATTTACAGCCACACGGCAGCTCTGCTCAGTGGGAAGATCATATGAATTAGATGAAGTTGTATTATATATCATCATAAAACCTGGCAATGTCAACTGCAGCCATGGCCGGGAACGAGTTTTTTTGGAGGGTTTCTGCTAAAAGTCTATTCATCAGAGCAGATTGTGTGTGGATGGATGAAGCCATGTGTATTCTGGGATGTTGGAGCTGTGTCAGTAATCTTCCTCTGTTTGCTTTGTGTTTT[A/C]GTGTTGAGTATCCGTGGAGCTCAGGAGGAGGAGCCTCCCGACGCTCAGCTGATGCGATTGGACAACATGCTGCTGGCGGAGGGCGTGTCCGGGCCGGAGAAAGGGGGCGGGTCTGCGGCGGCAGCGGCTGCAGCTGCGGCTTCAGGAGGAGTCGGAGCCGATAACTCCGCCGAACACTCTGACTACAGAGCCAAACTCTCACAGATCCGCCAGATCTACCACACTGAGCTGGAGAAATACGAGCAGGTCAGCAAACATGTAATAATGATAATATATTTCTTTATTTATTTTATTTATTATTGATTTGAAATAATGGGACTAAGCCGAAAAGAAAATGGATGAATTGATTTGAAATATGCTTGTGGTGGGAGACAAACAAACTGGCGCAGTAGGTAGTGCGGTCGCCTCACAGCAAGAAGGTTACTGGTTTGAGCCTCGGCTCAGTTGGTGTTTCTGTGTGGAGTTTGCATGTTCTCCCTGCGTTCGCATGGGTTTCCTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa26652
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122028 Nonsense 166 275 5 9
ENSDART00000125538 Nonsense 237 429 5 10
ENSDART00000129503 Nonsense 237 429 5 9
Genomic Location (Zv9):
Chromosome 6 (position 2177908)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 2183735
GRCz11 6 2381688
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CATCTGATTTCTCTCTCTCTCTCTCTCGCTCTCTTCACAGGAGGAAAAGA[C/T]GAAACTTCAACAAACAGGCCACAGAGATCCTGAATGAGTATTTTTACTCT
Long Flanking Sequence:
GCGGAATGGACCACCAACTTTTTCCAGCATATGTTTTACACAGCGGTTGCCCTTCCAGCTGCAACCCAGTACTGGGAAACATCCATACACACTCATTCACACACACACACACACATACACACTACGGCCAATTAAGTTACTTCAGTTCCCCCATAGCGCATGTGTTTGGACTGTGGGGGAAACCGGAGTACCCGGAGGACTTGAACCAGCCAGCCAGGGCTTGAACTAGCGACCTTCTTGCTGTGAGGTTACAGTGCTAACCACTGAGCCACAGTGCCGCTCTTCATTCCATTTTTGAAATTTTAGCTTACTAGTTTATAAAACCTGGAGTGATTCTTAACCAAATGATTTGTCTCTAAAATTTCTCCAAAGTAATGGTTCATTATTGTGGCCTTTTCTATATTTGCCAATATGAAGCATTAATTATATGCAAAGAAAAAAGTATGTTCACATCTGATTTCTCTCTCTCTCTCTCTCGCTCTCTTCACAGGAGGAAAAGA[C/T]GAAACTTCAACAAACAGGCCACAGAGATCCTGAATGAGTATTTTTACTCTCACCTCAGTAACCCGTATCCCAGTGAGGAGGCCAAAGAGGAGCTGGCCAAGAAATGCTCCATCACCGTCTCACAGGTGCTGAAATACACATCGCTGACAATCCTCTCTGACATTACGCCCTGAAAACATAGATATAGATCCTACTTTAGTCAAAATACAGACCCCACTATATTGCAATTGCTTGTAATATGATGATTCCAAAATTAAAGATGTGGCTTGCAATTTCCAGCATACTTTTCATGTACTGTACTACTCATAGGCTGTGTCTGAAATCGCCTCCTACTCAGTTGGTACTGCATTTGAATTTACACGTACTACTCAACCATTAGAAAAGGATGTTCTATATACAGTGGGAATGTGAGTAGTATGAATGGAACTCGGACGTAGTACATCTGTCAATTTGGTCACGTGATCTACCCACATCAGTTGCCATTCTTGAATTGTGTCGCA
Associated Phenotype:
Not determined