Busch Lab

ZMP

TTC28 (2 of 2)

Ensembl ID:
ENSDARG00000089527
Description:
tetratricopeptide repeat domain 28 [Source:HGNC Symbol;Acc:29179]
Human Orthologue:
TTC28
Human Description:
tetratricopeptide repeat domain 28 [Source:HGNC Symbol;Acc:29179]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa18287 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa18287
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130461 Essential Splice Site 59 166 3 3
Genomic Location (Zv9):
Chromosome 10 (position 3892518)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 3884512
GRCz11 10 3884816
KASP Assay ID:
2260-2781.1 (used for ordering genotyping assays)
KASP Sequence:
TCTATTAATATTCTACTAATCCCTAATGTTKCTTTCATTCATTTGCCTGC[A/T]GAAWCACTAGAGCCGACCTAYCAGCAGCTGCAGAAGATGAAGCTGGACAA
Associated Phenotype:
Not determined