Busch Lab

ZMP

ugt1b4

Ensembl ID:
ENSDARG00000089507
ZFIN IDs:
ZDB-GENE-080227-10, ZDB-GENE-080227-11, ZDB-GENE-080227-12, ZDB-GENE-080227-13, ZDB-GENE-080227-14, ZDB-GENE-080227-15
Description:
UDP glucuronosyltransferase 1 family, polypeptide B7 precursor [Source:RefSeq peptide;Acc:NP_001166
Human Orthologues:
UGT1A1, UGT1A10, UGT1A3, UGT1A4, UGT1A5, UGT1A6, UGT1A7, UGT1A8, UGT1A9
Human Descriptions:
UDP glucuronosyltransferase 1 family, polypeptide A1 [Source:HGNC Symbol;Acc:12530]
UDP glucuronosyltransferase 1 family, polypeptide A10 [Source:HGNC Symbol;Acc:12531]
UDP glucuronosyltransferase 1 family, polypeptide A3 [Source:HGNC Symbol;Acc:12535]
UDP glucuronosyltransferase 1 family, polypeptide A4 [Source:HGNC Symbol;Acc:12536]
UDP glucuronosyltransferase 1 family, polypeptide A5 [Source:HGNC Symbol;Acc:12537]
UDP glucuronosyltransferase 1 family, polypeptide A6 [Source:HGNC Symbol;Acc:12538]
UDP glucuronosyltransferase 1 family, polypeptide A7 [Source:HGNC Symbol;Acc:12539]
UDP glucuronosyltransferase 1 family, polypeptide A8 [Source:HGNC Symbol;Acc:12540]
UDP glucuronosyltransferase 1 family, polypeptide A9 [Source:HGNC Symbol;Acc:12541]
Mouse Orthologues:
Ugt1a1, Ugt1a10, Ugt1a2, Ugt1a5, Ugt1a6a, Ugt1a6b, Ugt1a7c, Ugt1a8, Ugt1a9
Mouse Descriptions:
UDP glucuronosyltransferase 1 family, polypeptide A1 Gene [Source:MGI Symbol;Acc:MGI:98898]
UDP glucuronosyltransferase 1 family, polypeptide A2 Gene [Source:MGI Symbol;Acc:MGI:3576049]
UDP glucuronosyltransferase 1 family, polypeptide A5 Gene [Source:MGI Symbol;Acc:MGI:3032634]
UDP glucuronosyltransferase 1 family, polypeptide A6A Gene [Source:MGI Symbol;Acc:MGI:2137698]
UDP glucuronosyltransferase 1 family, polypeptide A6B Gene [Source:MGI Symbol;Acc:MGI:3580629]
UDP glucuronosyltransferase 1 family, polypeptide A7C Gene [Source:MGI Symbol;Acc:MGI:3032636]
UDP glucuronosyltransferase 1 family, polypeptide A8 Gene [Source:MGI Symbol;Acc:MGI:3576090]
UDP glucuronosyltransferase 1 family, polypeptide A9 Gene [Source:MGI Symbol;Acc:MGI:3576092]
UDP glycosyltransferase 1 family, polypeptide A10 Gene [Source:MGI Symbol;Acc:MGI:3580642]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa35115 Nonsense Mutation detected in F1 DNA Not yet available
sa35116 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa35115
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122424 None None 542 None 5
ENSDART00000123244 None None 535 None 5
ENSDART00000126815 None None 528 None 5
ENSDART00000127075 None None 529 None 5
ENSDART00000127797 None None 531 None 5
ENSDART00000128276 Nonsense 187 533 1 5
Genomic Location (Zv9):
Chromosome 11 (position 31182619)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 30059981
GRCz11 11 30307165
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAACCTATCTGTGCCTGCAGTGTACATGCTAAGAGGAATAATGTGTGAAT[C/A]GAAAGCCACAGCGTGTCCGAACCCACCCTCTTATATTCCACGTTTCTTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35116
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122424 Essential Splice Site 376 542 3 5
ENSDART00000123244 Essential Splice Site 369 535 3 5
ENSDART00000126815 Essential Splice Site 362 528 3 5
ENSDART00000127075 Essential Splice Site 363 529 3 5
ENSDART00000127797 Essential Splice Site 365 531 3 5
ENSDART00000128276 Essential Splice Site 367 533 3 5
Genomic Location (Zv9):
Chromosome 11 (position 31199847)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 30077209
GRCz11 11 30324393
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCCTGAAAATGTCAAACTGATGAAATGGCTTCCACAGAATGACTTGCTTG[G/T]TGAGTTTTTTTTTTTTTTAGATGCTTAGCTTGCATTCTTCTATGCAATGG
Associated Phenotype:
Not determined