Busch Lab

ZMP

si:ch211-105c13.3

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa22825 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa22825
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124713 Nonsense 82 91 2 2
ENSDART00000140953 Nonsense 82 91 3 4
ENSDART00000143836 Nonsense 82 91 3 3
Genomic Location (Zv9):
Chromosome 16 (position 24877247)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 22781563
GRCz11 16 22696953
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCCAGGAGTACATGACGCTGGTAGGCTACCTAGCCACCTCACTGAGCGAG[C/T]AGAAGGCCAGCGGACAAGAAGACAAGCACTGATGACACCTGTAATGATCA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa28650
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124713 None None 91 None 2
ENSDART00000140953 Essential Splice Site None 91 3 4
ENSDART00000143836 None None 91 3 3
Genomic Location (Zv9):
Chromosome 16 (position 24877161)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 22781477
GRCz11 16 22696867
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CACCTGTAATGATCATTTGTGGAGCTGGGTTCTTACTCCAAGTACTCATG[G/A]TAAATAAAATACCATTTTCTAGACAAGCAAAACATACTGGCTTTTTTTAG
Associated Phenotype:
Not determined