Busch Lab

ZMP

NAV1 (3 of 3)

Ensembl ID:
ENSDARG00000089438
Description:
neuron navigator 1 [Source:HGNC Symbol;Acc:15989]
Human Orthologue:
NAV1
Human Description:
neuron navigator 1 [Source:HGNC Symbol;Acc:15989]
Mouse Orthologue:
Nav1
Mouse Description:
neuron navigator 1 Gene [Source:MGI Symbol;Acc:MGI:2183683]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa8611 Nonsense Mutation detected in F1 DNA Not yet available
sa9298 Nonsense Mutation detected in F1 DNA Not yet available
sa10347 Nonsense Available for shipment Available now
sa45268 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa8611
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122130 Nonsense 63 649 1 6
Genomic Location (Zv9):
Chromosome 6 (position 54862380)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 54879209
GRCz11 6 54889022
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GGCYGTCCTGACGGATGCTGAGAAGAAGATGCAGCTCTATGAGCCCAAGT[G/A]GTGYGATGACATGAGYAAAGCTGCTTCAGGACACCTGAAGAAGCCTAAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9298
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122130 Nonsense 125 649 1 6
ENSDART00000122130 Nonsense 125 649 1 6
Genomic Location (Zv9):
Chromosome 6 (position 54862565)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 54879394
GRCz11 6 54889207
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AAGCATTCACCCCACTTGCAGCACCGGGAAAAGGCCAAAGTCGGATCCCT[C/T]GAGGCCCCTACGCGGAAGTAAAACCCTTGAGCAAGACAWCYGATGACTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10347
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122130 Nonsense 125 649 1 6
ENSDART00000122130 Nonsense 125 649 1 6
Genomic Location (Zv9):
Chromosome 6 (position 54862565)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 54879394
GRCz11 6 54889207
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AAGCATTCACCCCACTTGCAGCACCGGGAAAAGGCCAAAGTCGGATCCCT[C/T]GAGGCCCCTACGCGGAAGTAAAACCCTTGAGCAAGACAWCYGATGACTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45268
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122130 Nonsense 435 649 5 6
Genomic Location (Zv9):
Chromosome 6 (position 54933639)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 54949950
GRCz11 6 54959763
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCGTGGTACAGTGAGGACAGTAAATGTTTACGGAAAACCGATGGAGTTTA[T/G]GACACCGGCAGCCTTAAAAGTGAGCCGTCCTGCAAGTGGAGGAAAACTCG
Associated Phenotype:
Not determined