Busch Lab

ZMP

si:dkey-283b15.3

Ensembl ID:
ENSDARG00000089435
ZFIN ID:
ZDB-GENE-100922-36
Human Orthologues:
DST, MACF1
Human Descriptions:
dystonin [Source:HGNC Symbol;Acc:1090]
microtubule-actin crosslinking factor 1 [Source:HGNC Symbol;Acc:13664]
Mouse Orthologues:
Dst, Macf1
Mouse Descriptions:
dystonin Gene [Source:MGI Symbol;Acc:MGI:104627]
microtubule-actin crosslinking factor 1 Gene [Source:MGI Symbol;Acc:MGI:108559]

Alleles

There are 7 alleles of this gene:

Allele Name Consequence Status Availability
sa13927 Nonsense Available for shipment Available now
sa42652 Nonsense Mutation detected in F1 DNA Not yet available
sa45562 Nonsense Mutation detected in F1 DNA Not yet available
sa12044 Nonsense Available for shipment Available now
sa42653 Nonsense Mutation detected in F1 DNA Not yet available
sa36031 Nonsense Mutation detected in F1 DNA Not yet available
sa42654 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa13927
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000129010 Nonsense 583 1440 11 29
ENSDART00000147973 None None 241 None 5
Genomic Location (Zv9):
Chromosome 16 (position 6821562)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 5666093
GRCz11 16 5565719
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ACAGCKTATGCATCCTGGAGCAGAAGTGGAGTGCCGTCTACGCTAAAATG[C/T]AGGAGCGAAAGGTGATGAGAGATTATTGTGCATGAATAAACGGCRATWAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42652
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000129010 Nonsense 589 1440 12 29
ENSDART00000147973 None None 241 None 5
Genomic Location (Zv9):
Chromosome 16 (position 6823415)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 5667946
GRCz11 16 5567572
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AATACGTTTTTAAAATTATTTATGGATTTATTGATTGTTTTAGGCAAAGT[T/G]AACTGAGGGTCTTGGCCTTGCGAAGGAGTTCAACAGTAACGTCCAGGACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45562
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000129010 Nonsense 674 1440 13 29
ENSDART00000147973 None None 241 None 5
Genomic Location (Zv9):
Chromosome 16 (position 6824576)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 5669107
GRCz11 16 5568733
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAGCCACACGTCTGTCTGAGCTCAGCAGGAAAGAGGACTGTGATGTCATA[C/T]AGAACCTGATCATGACCATTCAGGACCGATTCAAAAAACTCCTGCAGCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12044
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000129010 Nonsense 894 1440 17 29
ENSDART00000147973 None None 241 None 5
Genomic Location (Zv9):
Chromosome 16 (position 6827930)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 5672461
GRCz11 16 5572087
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGCGGGATCTGACGCGCAGCAGCACCGCCGATGCTCACTGGCTGCAGGAG[C/T]ARATGGAGGAGCTGGAGAGYCGCTGGGAGGCTGTGTGTAAACTCTCTGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42653
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000129010 Nonsense 1102 1440 21 29
ENSDART00000147973 None None 241 None 5
Genomic Location (Zv9):
Chromosome 16 (position 6833679)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 5678210
GRCz11 16 5577836
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TACCGGAGGTTGAAAATGCCACTAAATCCTGTAAACACAAGCTGGTCCCC[A/T]AACAGCAGGTTTCACCCAGTCGCAGACCAGCAGCGAGTGAGTCCAGAATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36031
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000129010 Nonsense 1207 1440 23 29
ENSDART00000147973 Nonsense 39 241 1 5
Genomic Location (Zv9):
Chromosome 16 (position 6835701)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 5680232
GRCz11 16 5579858
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTCACCTCAAATCCCGAATTCTGGATGTTTTCCGAAGCATTGATCGAGAT[C/T]AGGATGGCAGAATCACTCATAAGGAGTTTATTGACAGTGTTCTGGCCTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42654
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000129010 Nonsense 1250 1440 24 29
ENSDART00000147973 Nonsense 82 241 2 5
Genomic Location (Zv9):
Chromosome 16 (position 6835991)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 5680522
GRCz11 16 5580148
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCGGTTGCCAACATATTTGATGTTAACGGAGACGGATTCATTGACTATTA[T/G]GAGTTTGTGAGTGCGCTTCACCCCAGCAGAGACCCTTACAGGAGGACAGT
Associated Phenotype:
Not determined