Busch Lab

ZMP

ENSDARG00000089433

Ensembl ID:
ENSDARG00000089433

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa24097 Nonsense Available for shipment Available now
sa10733 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa24097
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127140 Nonsense 56 253 3 6
Genomic Location (Zv9):
Chromosome 22 (position 11775766)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 11635934
GRCz11 22 11665616
KASP Assay ID:
2261-6503.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTGTCACTCTGCATATTAATCAGACTTTTACTGACATAAGAAGACATTAT[C/T]AGCGTCCTTTATGGTGGTTTGGACCTGAAGATACTCCTATAGTTAGACTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10733
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127140 Nonsense 123 253 3 6
Genomic Location (Zv9):
Chromosome 22 (position 11775967)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 11636135
GRCz11 22 11665817
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ACATYGAARCCAAACACTCTGGACTTTACAGACTTCGRTTTAGATTMTTT[A/T]GAGAATCATTCAATGTTACTGTCTATGGTGAGTAGCTGATTTAATGTGGC
Associated Phenotype:
Not determined