Busch Lab

ZMP

ftr37

Ensembl ID:
ENSDARG00000089388
ZFIN ID:
ZDB-GENE-070912-486
Description:
Novel protein similar to H.sapiens tripartite motif-containing [Source:UniProtKB/TrEMBL;Acc:B0S6J1]
Human Orthologue:
TRIM65
Human Description:
tripartite motif-containing 65 [Source:HGNC Symbol;Acc:27316]
Mouse Orthologue:
Trim65
Mouse Description:
tripartite motif-containing 65 Gene [Source:MGI Symbol;Acc:MGI:2442815]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa11616 Nonsense Available for shipment Available now
sa19917 Essential Splice Site Available for shipment Available now
sa31305 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa11616
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061172 Nonsense 174 199 1 2
ENSDART00000100987 Nonsense 174 557 1 6
ENSDART00000134662 Nonsense 174 506 1 6
Genomic Location (Zv9):
Chromosome 2 (position 60171335)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 59248126
GRCz11 2 59345352
KASP Assay ID:
2259-2850.1 (used for ordering genotyping assays)
KASP Sequence:
GARAAACCCCTGGAGATCTTCTGCCGCACTGATCAGCKATGTATATGTTA[T/A]CTKTGTACAATGGATCAACACAAAAACCACAAYACTGTTTYAGCTGYWGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19917
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061172 None None 199 None 2
ENSDART00000100987 None None 557 None 6
ENSDART00000134662 Essential Splice Site 360 506 4 6
Genomic Location (Zv9):
Chromosome 2 (position 60167466)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 59244257
GRCz11 2 59341483
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGATCTGGAGCATTTCGGCAAAAAGGAGATAAAGTTGATTTCTAGAAGAG[G/A]TCAGATTTATATTTCCTGACATGTTTCAGATGATTTTAAATGTATTTGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31305
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061172 None None 199 None 2
ENSDART00000100987 Nonsense 473 557 6 6
ENSDART00000134662 None None 506 None 6

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 60071325)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 59148116
GRCz11 2 59245342
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCATCAGCAGGAAGGGTTCGGGTAATGAGTGTGGATTTGGACGCAATGAT[C/T]AGTCCTGGAGTTTGGAGTACTCTTCTCACAGTTTCTCATTCTATCATAAT
Associated Phenotype:
Not determined