Busch Lab

ZMP

FDXR

Ensembl ID:
ENSDARG00000089369
Description:
ferredoxin reductase [Source:HGNC Symbol;Acc:3642]
Human Orthologue:
FDXR
Human Description:
ferredoxin reductase [Source:HGNC Symbol;Acc:3642]
Mouse Orthologue:
Fdxr
Mouse Description:
ferredoxin reductase Gene [Source:MGI Symbol;Acc:MGI:104724]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa22171 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa22171
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126405 Essential Splice Site 170 486 5 12
Genomic Location (Zv9):
Chromosome 12 (position 46025981)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 44920738
GRCz11 12 45291520
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAGCTAAAGACTTTGTTGGATGGTACAACGGGGTTCCCAGCAATACGGAG[G/A]TTCTGGTTGTTTTAAATCACACCACATGCTTTTGTGTTTAAAGTTTAAAA
Associated Phenotype:
Not determined