Busch Lab

ZMP

zgc:113131

Ensembl ID:
ENSDARG00000089357
ZFIN ID:
ZDB-GENE-050320-135
Description:
Protein FAM73B [Source:UniProtKB/Swiss-Prot;Acc:Q5BLE2]
Human Orthologue:
FAM73B
Human Description:
family with sequence similarity 73, member B [Source:HGNC Symbol;Acc:23621]
Mouse Orthologue:
Fam73b
Mouse Description:
family with sequence similarity 73, member B Gene [Source:MGI Symbol;Acc:MGI:1922035]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa29498 Nonsense Mutation detected in F1 DNA Not yet available
sa12133 Nonsense Available for shipment Available now
sa37215 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa29499
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122699 Essential Splice Site 229 565 5 14
Genomic Location (Zv9):
Chromosome 21 (position 4309104)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 3705990
GRCz11 21 3869000
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGAGGACTTCGGCAGCACAATCCCACCTGACAGTCTGCTTGCAGATCTGG[G/A]TAAAATATACACAAATCCATGCTAACCAAACACATTTCAGGTTCTTAAAG
Long Flanking Sequence:
TTGTTTATTTTTCTTTGGCTTAGTCTCTTATTTATCAATGGTCGCCACAGTGAAATGGACCATCAACTATTCTGCCATATGTTTTTACGATATGGATGCCCTTCCAACCGCCCAGTACTCATACTTAACTCACTCTCGTACATTACAGCCATTTAAGTTAGTCCAGTTCACCTATAGCGCATGTGTTTGGCGAATCCGGAGCACCCGGAAGAAACCCACCCCAACACGGGGAGAACATGCAAACTCCAGTCAGAAATGCCAACTGACCAACCTGGGACTCAATCCAGCGAACTTCATGCTGTGTGGTCACATTTTTGTGAAACATTTCAAAATGCGCATATAAATAGGTGGATGTAAACTAATGATGCTTATTGATTTCCAGCCCGAAGTTCGTAATCATCAGTTTGCAGAGAAGCTGGAGACTCTGCTGCACAGAGCTTATCATCTGCAGGAGGACTTCGGCAGCACAATCCCACCTGACAGTCTGCTTGCAGATCTGG[G/A]TAAAATATACACAAATCCATGCTAACCAAACACATTTCAGGTTCTTAAAGGAACACTCCATTTTTTTTTTTTTTTTTGGAAATTGGCTTTTTTTCTGCCTCTCCTAGAGGTAAATAGTTGAGTATCACCACCACATAATACTTAATACACACATGCATGGAAACAAAACTATACAAAACAAGTTTGTTGCTAGCGTATATAAATAAATATATCAAATGTATCATATGCATGTATAATTTATTCTAAATATAATTTTTTTTTTCCACAAATATATGCATGTATTTATGTATAAATATTAAATAAACAACATACACACACTTAAACTGTCAACACAAACTTTTATTTTGTATGCGATCAATCATGATATAGTTTTACTCAGCACTAGTTATTATGCATGTTTTTTGGGGGGGGTTTGCATTTAAAAAATATTCATTGCTTGTTCATGTTAGCAAATACATAAACTAACATAAACTATGAATGTAACAGTTGTTTTGTCTAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa29498
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122699 Nonsense 266 565 7 14
Genomic Location (Zv9):
Chromosome 21 (position 4307108)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 3707727
GRCz11 21 3870737
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATTGTGACTTCAACTGTATGTGATGTCACTTCCCTTTCTGGTTTTGCAGT[T/A]GTTTGAGACGTTTTCTCTTGAGGACTCGTTTCATCTGCTGAAGCCGGCCG
Long Flanking Sequence:
CATAATATTTGACTAGATATTTTTTAAGACACTAGTATTCAGCTTAATGTGACATTTAAAGGCTTAACTAGGTTAATTAGGCAATTCATTGTATAACAGTGGTTGGTTCTGTTGACAATCCAAAGCAAATATTGCTTAAAAAGAGCTAATAATATGGACCTTAAATGGTTTATAAAAATTAAAAACTGTTCTTGTCGAAATAAAACAAATAAGACTTCCTCCAGAAGAAAAAATAATATAGGAATTACTGTGAAAATTTTCTGAATTAAAACATCATCTGAGAAATATAAAAATAATATAATAATAATGAGCTTTCCCAGTGATGGTTGCAGCTGGAAGGTCATCCGCTGCGTAAAACATATGCTAGATAAGTTGGCGATTTATTCCGCTGTGGCGACCCCAGATTAATAAAGGGACTAAACCAAAAAGAAAATCTAATCTAAGCTACTAATTGTGACTTCAACTGTATGTGATGTCACTTCCCTTTCTGGTTTTGCAGT[T/A]GTTTGAGACGTTTTCTCTTGAGGACTCGTTTCATCTGCTGAAGCCGGCCGCTCTCTATGAAGAAGCTCTGAGTTTGGTGAAAGATGGAGACGTGGCCTGCAGATCACTGAGGTAGAGCATATTAACATGATTAACTCTGCACACTGGATGTTATTGGGATAGTTTAGATGTTCTGCTTTCTCCTGGGATTTGAGGCTTTCCGCTGTAGCTCAGGGAGCAGAGACTGATGGGAACACACACACACAGTGTTATTTCGGTGTGTCTGTTACAGAACTGAACTGCTGGAGTGTTACAGCGATCAGGACTTCCTCGCTAAACTGCACTGCGTACGACAGGCATTCCAGGTCAGCACTCTCTCACACACCATTACACACACGCACATGCACATGCCCACATGACTACACACGCATGTTGACATGATTAAAAATGGACACAAATGCACACACCATTACACAAACACACAGACACACACACACACGGTTACACGCACACACATTCCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12133
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122699 Nonsense 285 565 7 14
Genomic Location (Zv9):
Chromosome 21 (position 4307050)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 3707785
GRCz11 21 3870795
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ACGTTTTCTCTTGAGGACTCGTTTCATCTGCTGAAGCCRGCCGCTCTCTA[T/A]GAAGAAGCTCTGASTTTGGTGAAAGATGGAGACGTGGCCTGCAGATCACT
Long Flanking Sequence:
AAGGCTTAACTAGGTTAATTAGGCAATTCATTGTATAACAGTGGTTGGTTCTGTTGACAATCCAAAGCAAATATTGCTTAAAAAGAGCTAATAATATGGACCTTAAATGGTTTATAAAAATTAAAAACTGTTCTTGTCGAAATAAAACAAATAAGACTTCCTCCAGAAGAAAAAATAATATAGGAATTACTGTGAAAATTTTCTGAATTAAAACATCATCTGAGAAATATAAAAATAATATAATAATAATGAGCTTTCCCAGTGATGGTTGCAGCTGGAAGGTCATCCGCTGCGTAAAACATATGCTAGATAAGTTGGCGATTTATTCCGCTGTGGCGACCCCAGATTAATAAAGGGACTAAACCAAAAAGAAAATCTAATCTAAGCTACTAATTGTGACTTCAACTGTATGTGATGTCACTTCCCTTTCTGGTTTTGCAGTTGTTTGAGACGTTTTCTCTTGAGGACTCGTTTCATCTGCTGAAGCCGGCCGCTCTCTA[T/A]GAAGAAGCTCTGAGTTTGGTGAAAGATGGAGACGTGGCCTGCAGATCACTGAGGTAGAGCATATTAACATGATTAACTCTGCACACTGGATGTTATTGGGATAGTTTAGATGTTCTGCTTTCTCCTGGGATTTGAGGCTTTCCGCTGTAGCTCAGGGAGCAGAGACTGATGGGAACACACACACACAGTGTTATTTCGGTGTGTCTGTTACAGAACTGAACTGCTGGAGTGTTACAGCGATCAGGACTTCCTCGCTAAACTGCACTGCGTACGACAGGCATTCCAGGTCAGCACTCTCTCACACACCATTACACACACGCACATGCACATGCCCACATGACTACACACGCATGTTGACATGATTAAAAATGGACACAAATGCACACACCATTACACAAACACACAGACACACACACACACGGTTACACGCACACACATTCCCACATGATTACAAATGCACTCATATGCATACATAGACACACACACACATACAAATGATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37215
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122699 Nonsense 492 565 14 14
Genomic Location (Zv9):
Chromosome 21 (position 4297138)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 3717690
GRCz11 21 3880700
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTATAAAGCGACCCTTGAGCTAATATCCCATTCTCCTTTACTCTCCACAG[C/T]AACAGATTGTTCAGTATCTGAAGGACATGTTTGACCATGATAAGGTGCGT
Long Flanking Sequence:
CCTACCCAATTCACCTGTATTGCATGTCTTTGGACTGTGGGGGAAACCGTAGCACCCGGAGGAAACCCACGCGAAGGCAGGGAGAACATGCAAACTCCACACAGAAACGCCAACTGAGCCGAGGTTCGAACCAGTGACCCAGTGACCTTCTTGCTGTGAGGCGACAGCACTACCCACTGCGCCACTGCCTCGCCCACATACCATCATACTAACAATATACTAATCCATACTAGAAACATGCTAATAAATGTGTACTTTTCTATCTCTGCCAACTGTTGCACACTTCTTAAAACTACTTAAATTATTTAAACTTTGAAACGACTTCAAACTTTCAGACTAGCCACCATAAAGTTTGTCAATGAACTTCACTTTTCTAGTTTGCTTTTAGGTTTGTACAGAACAGTGGCCAACAACTGTTGTTTTATTGTGCTTTATAAATAAATAAACCAACTATAAAGCGACCCTTGAGCTAATATCCCATTCTCCTTTACTCTCCACAG[C/T]AACAGATTGTTCAGTATCTGAAGGACATGTTTGACCATGATAAGGTGCGTTTCACATCCGTCCCATCTCTGGCTGAAGACATCCTCCGCCTGTCCCACAGACGAGCAGATATCCTGATGGGTTACCTAGGCATCGAAAATCTACCTGAGACCAATGGAGCTTTACCCAAGAGCCCCTGCCAAGCGGAAAGCGGGAATCTGGACGCCAGCGGACAGCAAGACTGAGCTTTAAGGTTGTTCTTCATTTAGCTCTTTATCATCAGACCAATCAAAAGCGTTCGCAGATTTACATTCGAGACCTTAGTTTTGTAGAATATACTGAGAGATCAACCACTACTGAGGTCAACCGAGGCCTTTTCTTCAGCTCTTTCTGCAAACTTTCCACCAAAATATCAAACGTTTTGTCACCGTAATCCAGCGCTGCTATTTATCCACCTTAATTTTATCAGGAAGACTCCATCATAACCCAAATGAACTGAATAAAACTCATCTTTTAGCCAA
Associated Phenotype:
Not determined