Busch Lab

ZMP

ENSDARG00000089356

Ensembl ID:
ENSDARG00000089356

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa43765 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa29712
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000129119 Nonsense 95 308 2 6
Genomic Location (Zv9):
Chromosome 22 (position 7698665)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 7630942
GRCz11 22 7660788
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTTTTGATGCTCCTGATGGGAGATTCAGAGACAGACTGAAGCTGGACAAT[C/T]AGACTGCATCTCTGACCATCACACACAGCAGAATCTCAGACTCTGGACTT
Long Flanking Sequence:
GTTTGGCATGTTTATATTCGTCTGTTTTGGAGTCTGACTGGTAAGTAACCCATTTCTTGGGCTAAGATTATACCCTAATTTCTGTACATAGCCTACACAAAAAAATCTGGTAACTAGCTGTTATTCCCATAATTGTTCCATGTTTATCAGACTAATGTAGGTCTACTGATATTAATTTTTCTCTTACAAGAATTTCAAAAAATGTTGGTTGGATTGAAACTCAAAACTGTTTAAAAGTTAACAAACAATAATAACAACAACAACAACAACAACAAAAACATTGTGTGTGTTTGTGTTGATCAGTTGTGTGTGGTGATGGAGTGAAGTCAGTGTCGGTCACTGAAGGAGATTCAGTCACTCTAGAGTCTGAAATACTGAGCAATGATCTGATAATGTGGAGATTTGGACCTAAAGAGGTTCTCTTAGCTAAAATCAGCAGAAAGAGGGAGACTTTTGATGCTCCTGATGGGAGATTCAGAGACAGACTGAAGCTGGACAAT[C/T]AGACTGCATCTCTGACCATCACACACAGCAGAATCTCAGACTCTGGACTTTATAAAGTGTACAGCCGCACTAAAGGAGAGACGCCACTCCACACATTCAGCCTTACTGTCTATGGTGAGTAAACTTGTTTGAACAAACAGCTAACAGTGTTTATTCTACTTTCAATTTTAAGCTATACATCTTAAGACAATAAAATAAGTTCAATAGATGAAATTAGTTAAACCTGGAATAACATTGATGTCTCGCTTGTTTTGCCAAGTTTAAATGACATACCATTTTCAGACTTCCTGCATACAGCATTATATTCAAATATAATTATTAAAAAATCTCATGATTCATCAAAAGCTTTTCGGTTAGTGTTGCCTCCATGCTAAACCAATTCTTCCTGTTTCAAATTGCTTTAAAAATAGTTTCAAAGTGTTTTTCTTCATCTAATTGATCATCTTTGGTCAGATTTTTATCCCCATTTATGTTTATTCTTTGATGTTTTTCAGCTTATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43765
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000129119 Nonsense 142 308 3 6
Genomic Location (Zv9):
Chromosome 22 (position 7699186)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 7631463
GRCz11 22 7661309
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGTTTATTCTTTGATGTTTTTCAGCTTATCTGCCTGCTCCTGTCATCATC[A/T]GAAACTGTTCATCATCATCATCATCATCATCATCAGATTGTTCAGTGGTG
Long Flanking Sequence:
ACACACAGCAGAATCTCAGACTCTGGACTTTATAAAGTGTACAGCCGCACTAAAGGAGAGACGCCACTCCACACATTCAGCCTTACTGTCTATGGTGAGTAAACTTGTTTGAACAAACAGCTAACAGTGTTTATTCTACTTTCAATTTTAAGCTATACATCTTAAGACAATAAAATAAGTTCAATAGATGAAATTAGTTAAACCTGGAATAACATTGATGTCTCGCTTGTTTTGCCAAGTTTAAATGACATACCATTTTCAGACTTCCTGCATACAGCATTATATTCAAATATAATTATTAAAAAATCTCATGATTCATCAAAAGCTTTTCGGTTAGTGTTGCCTCCATGCTAAACCAATTCTTCCTGTTTCAAATTGCTTTAAAAATAGTTTCAAAGTGTTTTTCTTCATCTAATTGATCATCTTTGGTCAGATTTTTATCCCCATTTATGTTTATTCTTTGATGTTTTTCAGCTTATCTGCCTGCTCCTGTCATCATC[A/T]GAAACTGTTCATCATCATCATCATCATCATCATCAGATTGTTCAGTGGTGTGTTCAGTGGTGAATGTGAGTGCTGTGAGTCTCTCCTGGTACAAAGGAAACAGTGTATTGTCCAGCATCAGTGTGTCTGATCTCAGCATCAGTCTCTCTCTTCCTCTGGAGGTGGAATATCAGGATAAAAACACCTACAGCTGTGTGATCAACAACACCATCAGCAACCAGACCACACAACAGGACATCGACACACTCTGCCACACATGTTCAGGTACAGATCAACTGATATGTGTTGTTTATTTACTAAAACTGACCTCTAAAGTCATTTAGTGCTGACAGTTTTTTTAACCTTAATACTTAGTTTTGTCTATTACAGATCAGGGTCATTCTTTATTGTACACAGTGCTGCCATCTGCTGGTGGATCTCTGTTGATTGTTCCTCTAGTCTTCTGGATCTACAGAAAGAAAAGGAAAACAAATCAAGGAGGCAAGTGTTAAGGCTGAATT
Associated Phenotype:
Not determined