Busch Lab

ZMP

zp3.2

Ensembl ID:
ENSDARG00000089352
ZFIN IDs:
ZDB-GENE-050626-121, ZDB-GENE-991129-7
Description:
zona pellucida glycoprotein 3.2 [Source:RefSeq peptide;Acc:NP_001020357]
Human Orthologues:
POMZP3, ZP3
Human Descriptions:
POM121 and ZP3 fusion [Source:HGNC Symbol;Acc:9203]
zona pellucida glycoprotein 3 (sperm receptor) [Source:HGNC Symbol;Acc:13189]
Mouse Orthologue:
Zp3
Mouse Description:
zona pellucida glycoprotein 3 Gene [Source:MGI Symbol;Acc:MGI:99215]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa42845 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa42844 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa42845
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074173 Essential Splice Site 213 427 2 8
Genomic Location (Zv9):
Chromosome 17 (position 2367256)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 2412901
GRCz11 17 2589287
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTATCCGCACTGATGGTGCAGTTGTTGGTGTTCAGTGCCACTATCCAAGG[T/C]ACATTAACGTCTTCGGTGCTTAATACAACAGGGTAAACCACTTCGGTTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42844
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074173 Nonsense 360 427 6 8
Genomic Location (Zv9):
Chromosome 17 (position 2365790)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 2411435
GRCz11 17 2587821
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTCTCCTGCAGATCTACATTACATGCATTGTGAGGGCCACTGTTGCTGCC[A/T]GACATAGTGACCATCTGCACAAGTCCTGCTCCTTTGCCAATGGGTATGTT
Associated Phenotype:
Not determined