Busch Lab

ZMP

zgc:165627

Ensembl ID:
ENSDARG00000089350
ZFIN ID:
ZDB-GENE-070615-39
Description:
coiled-coil domain-containing protein 46 [Source:RefSeq peptide;Acc:NP_001092719]
Human Orthologue:
CCDC46
Human Description:
coiled-coil domain containing 46 [Source:HGNC Symbol;Acc:28514]
Mouse Orthologue:
Ccdc46
Mouse Description:
coiled-coil domain containing 46 Gene [Source:MGI Symbol;Acc:MGI:1923673]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa40003 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa40003
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127973 Nonsense 31 297 2 8
Genomic Location (Zv9):
Chromosome 3 (position 11286311)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 55686534
GRCz11 3 55942386
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAAAATTCCGACTTCAACTGTATACGGTTTGTTTTCATGTCCTCAGATTT[T/A]GGACCGCAAGAATGGTGAAATTGATGAACTAAAGAGCCTGTATCGTGGTA
Associated Phenotype:
Not determined