Busch Lab

ZMP

si:ch211-198c19.1

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa9047 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa9047
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124433 Nonsense 86 164 1 1
ENSDART00000140148 Nonsense 86 164 2 2
Genomic Location (Zv9):
Chromosome 16 (position 40543922)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 37928722
GRCz11 16 37878754
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTTCATAATGAAGGGAACCTGCTCCCTCCATTGAAGGACAAACACACGTA[T/A]AAATACTTCACTATAGGAAACCTTCACTACCGGCACTCTGAGGATCTCCC
Long Flanking Sequence:
TGACTATGAAAGCTAGAGTTTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCAATAAGAATGTGTCTTTATTCGATATCCATGTGGATAAGACCAGGAAAATGCAATAAAATGTGGTTTTGATTTCATATTAACTGTAAGGATTATTGTCATCTTTTCTAGCTACACTTTAAAATTAAATTGCTCCTTCTCCCTGCAGACTCTAAACAGCAATGATTAAACACCTCAGCCTTTTGCTAGTCATCCTGGTCCTGGCCATTACAACATTAAACACTGAAGAGGAGCTGAAAAAATCTGGCTTTGGATTTCCACCGCCACGACACGGACTCGCTCTTCTGAAGTGGTACGTGAAAGACTGCATCGACAATAACATGAAGGCTCTCTGTAATCCTGTAACTGGAGAGTTTGGGTTCCACGTGTTTCATAATGAAGGGAACCTGCTCCCTCCATTGAAGGACAAACACACGTA[T/A]AAATACTTCACTATAGGAAACCTTCACTACCGGCACTCTGAGGATCTCCCCTATGAAGTGAGGAAGTACTATGATCCACATGATCAACGAAGCAACATGGACAGAGTCCTTGTGAAGCTCAACCTGAACAAGAATCAAATTGAAGAGATCTACATATCAGAGCACTATAATCCCCCCAGAACTTTTCGTTTAGGGGTCTCTCTCATCGATGAGCTGAGATCGCATACAAAATATTGAATCTATTGAAACATCTCAGTGAAGTTTAACAGAGCAAGGATTTTTCTCACAGTATTTATGATTCTAATTCTTATTTCTTTTGATTCAATTCATTTCATCTTTATTTCTATAGCGCTGTTACAATGATTATGTCAAAGTAGCTTCACTTAGAAGATTATTGTAAATTGAAACAGTGTCAGTCCAGGTTTCAGAGTTGAAGTTCAGTTTGGTTCAGTGTGGTTTAATTTTCACTGCTGAAAGTCCTACACTGAAGAGCACATAAA
Associated Phenotype:
Not determined