Busch Lab

ZMP

LOC100332923

Ensembl ID:
ENSDARG00000089298
Human Orthologue:
SHISA6
Human Description:
shisa homolog 6 (Xenopus laevis) [Source:HGNC Symbol;Acc:34491]
Mouse Orthologue:
Shisa6
Mouse Description:
shisa homolog 6 (Xenopus laevis) Gene [Source:MGI Symbol;Acc:MGI:2685725]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability

Mutation Details

This allele has been removed from public view.

Allele Name:
sa30474
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126522 Essential Splice Site 46 254 1 4
Genomic Location (Zv9):
Chromosome Zv9_NA325 (position 20610)
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TACGAGATGGCCATGAAAGCAGACTTAGGTGAACAATCAACACTCCATTT[A/T]CTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGT
Associated Phenotype:
Not determined