Busch Lab

ZMP

LPHN1 (1 of 4)

Ensembl ID:
ENSDARG00000089292
Description:
latrophilin 1 [Source:HGNC Symbol;Acc:20973]
Human Orthologue:
LPHN1
Human Description:
latrophilin 1 [Source:HGNC Symbol;Acc:20973]
Mouse Orthologue:
Lphn1
Mouse Description:
latrophilin 1 Gene [Source:MGI Symbol;Acc:MGI:1929461]

Alleles

There are 8 alleles of this gene:

Allele Name Consequence Status Availability
sa45156 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa40154 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa20133 Nonsense Available for shipment Available now
sa40153 Nonsense Mutation detected in F1 DNA Not yet available
sa26145 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa33299 Nonsense Mutation detected in F1 DNA Not yet available
sa33298 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa45156
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124480 Essential Splice Site 11 1474 2 30
Genomic Location (Zv9):
Chromosome 3 (position 48834061)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 50834954
GRCz11 3 47646454
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGTGATTAGGACACATGAGAGTTGCTTTTCTATTCTGGAGGCTTGCGTTA[G/A]GTTGGTGGATGGCAGCCGGAGAAGAGCTGTGTGAAAGAGTGGGAGGATGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40154
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124480 Essential Splice Site 96 1474 3 30
Genomic Location (Zv9):
Chromosome 3 (position 48832653)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 50833546
GRCz11 3 47645046
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGAATGTACAGTGCTACCTACCAGACGCCTTCAAGATCATGTCACAGAGG[T/C]ACACCAGAGCACTGTTCTGCTGCAGGATCTATTTTTGTGGTGGTTTTTAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20133
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124480 Nonsense 144 1474 5 30
Genomic Location (Zv9):
Chromosome 3 (position 48760990)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 50761883
GRCz11 3 47573377
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCTCTCTCTCTCTTCCACATCTCCAGTCTTTGTATGTCCTGGGACTCTAT[T/A]AAGGGTGCAGGCAGCAAGTTTGCTGCAGGAGGCGGAGCATCAGTCGGGGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40153
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124480 Nonsense 197 1474 5 30
Genomic Location (Zv9):
Chromosome 3 (position 48760832)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 50761725
GRCz11 3 47573219
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CGTACCGCACAGATATGCTGTACGAGTATGCTTCATGGGAAGACTTCAAG[C/T]AGAATCGAGCCACAACCACCTACAAGTGAGTGACGATCTTAGTGTTAGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa26145
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124480 Essential Splice Site 205 1474 5 30
Genomic Location (Zv9):
Chromosome 3 (position 48760806)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 50761699
GRCz11 3 47573193
KASP Assay ID:
2259-4070.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TATGCTTCATGGGAAGACTTCAAGCAGAATCGAGCCACAACCACCTACAA[G/T]TGAGTGACGATCTTAGTGTTAGGAACCAATGACCATCTCTGTGGATAACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33299
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124480 Nonsense 376 1474 7 30
Genomic Location (Zv9):
Chromosome 3 (position 48759868)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 50760761
GRCz11 3 47572255
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TACCCTTCCCCAATCCATACCAGTATGTGTCTTCTGTGGACTACAACCCA[C/T]GAGACAATCAACTTTATGTCTGGAATAACTACAATGTACTGCGCTACCCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33298
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124480 Nonsense 561 1474 10 30
Genomic Location (Zv9):
Chromosome 3 (position 48753139)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 50754032
GRCz11 3 47563619
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCCGAGCCCTTATTTTCTGTCCTGCCGCTGTACCGCTACCTCAGCTATTA[T/A]CATTCCGGCCTCAGCTCACATTACAGCACACAGGTCATTCCTCTGACATG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa18767
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124480 Nonsense 962 1474 21 30
Genomic Location (Zv9):
Chromosome 3 (position 48725570)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 50726710
GRCz11 3 47537350
KASP Assay ID:
2259-4069.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTCTTTGAGAGCGAATACTCCCGGAAGAAATACTACTACCTTTGTGGCTA[C/A]TGCTTTCCAGCCCTGGTGGTGGGCATCTCAGCAGCCATCGACTACCGCAG
Associated Phenotype:
Not determined