Busch Lab

ZMP

RNF31 (1 of 3)

Ensembl ID:
ENSDARG00000089229
Description:
ring finger protein 31 [Source:HGNC Symbol;Acc:16031]
Human Orthologue:
RNF31
Human Description:
ring finger protein 31 [Source:HGNC Symbol;Acc:16031]
Mouse Orthologue:
Rnf31
Mouse Description:
ring finger protein 31 Gene [Source:MGI Symbol;Acc:MGI:1934704]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa19780 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa19780
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124141 Essential Splice Site 254 359 8 11
Genomic Location (Zv9):
Chromosome 2 (position 27843322)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 28157900
GRCz11 2 27813536
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGTAATTTGTCCTCCACAAAAAAGACGGTCTCTGATTCTTCTTCAGTAGT[T/A]AAGTGTAATGACCCAAGCATGCTGGACCCAGGTGAGGATGCTCCAAACAT
Associated Phenotype:
Not determined