Busch Lab

ZMP

TANC1 (1 of 2)

Ensembl ID:
ENSDARG00000089190
Description:
tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 1 [Source:HGNC Symbol;Acc:29364]
Human Orthologue:
TANC1
Human Description:
tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 1 [Source:HGNC Symbol;Acc:29364]
Mouse Orthologue:
Tanc1
Mouse Description:
tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 1 Gene [Source:MGI Symbol;Acc:MG

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa16174 Nonsense Available for shipment Available now
sa21607 Nonsense Available for shipment Available now
sa13313 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa16174
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114222 Nonsense 278 1683 6 24
Genomic Location (Zv9):
Chromosome 9 (position 53642892)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 52581353
GRCz11 9 52109827
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
STGCAGCGACGAGCTCCACTAAGCTGGAGGATCTCAGTTTTCTTGATGAA[C/T]AGCGAAACACCCCCCTGCGCACCTCCATCCGCCTGCCCTGGCACAACACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21607
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114222 Nonsense 308 1683 7 24
Genomic Location (Zv9):
Chromosome 9 (position 53636481)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 52574942
GRCz11 9 52103416
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACCTGAGTAACCCTGTGCTGTACATGTTTTGCAGCTTGCTTTGCTCCGTA[C/A]AAGCCCACCGACATCATGCTTAAGCCGCTGCTGTTTGAGGTTCCCAGCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13313
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114222 Nonsense 682 1683 11 24
Genomic Location (Zv9):
Chromosome 9 (position 53590479)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 52528940
GRCz11 9 52057414
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ATCAAGAGCGCCAGCTATAAAGTAGTGCCCGTGWCTCTCTCTGAGCTCTA[T/A]CTGYTGCAGTGCAAMATGAAGTTTCTGAGTAACTCKGCGTTTGAGCGGGC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27496
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114222 Nonsense 1588 1683 24 24
Genomic Location (Zv9):
Chromosome 9 (position 53533537)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 52471998
GRCz11 9 52000472
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATTATAAACCGCGTCCGTTCATGGGGGTCATGGATAAAACGGCTCGTTTT[C/T]AGCAGCCGACGGCCACTCGGAGCTGGCAGAGTCACTCTACTGACGGTGTC
Associated Phenotype:
Not determined