Busch Lab

ZMP

zgc:136808

Ensembl ID:
ENSDARG00000089177
ZFIN ID:
ZDB-GENE-060519-40
Description:
hypothetical protein LOC692332 [Source:RefSeq peptide;Acc:NP_001038763]
Human Orthologue:
CYP46A1
Human Description:
cytochrome P450, family 46, subfamily A, polypeptide 1 [Source:HGNC Symbol;Acc:2641]
Mouse Orthologue:
Cyp46a1
Mouse Description:
cytochrome P450, family 46, subfamily a, polypeptide 1 Gene [Source:MGI Symbol;Acc:MGI:1341877]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa43378 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa15302 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa43378
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122892 Essential Splice Site 45 491 2 15
Genomic Location (Zv9):
Chromosome 20 (position 5330758)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 5246351
GRCz11 20 5290758
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AATGTTGAAAACTGTATAAATTAACGTGAAACTGAACTGATATCCTGACA[G/A]TTTTCTGCTGGGACATATTCCAACTATTAACAGAGTGACAAAGTCGGAAA
Long Flanking Sequence:
GAGTGTGTTTTCAGACGATAAACCGCAAAATAAAACTTGTATTATGCTAATTATAATGTCCAAAATGTCCTAAAGTTTTGTTGAAATGTAGGAATGGAAGGTTAGCACTGCCCTCTATCGCCAAAACCGATGTGAAACACGTCTTAAACACCCGGAAATAAGAAAAACATTCCAAGTTTGACATTAGATCGCCGAAAGGCAGACAGACGTACAGTACGCCGAGCTACTGTAACCGACAGCACCATCATGACATCGGAGTGGCTCTTGTATATGGTGTTTTACCTTCTTTCTGCTGTTTTCGTTGTATTTCTTGCATACTGTCTGTATATTCATCAAGTTCACCAGAAATATGATCATATACCTGGACCTCCTAGAGACAAGTAAGAAAGTTAAATCAATTGATCTTTTCATGAATGTGTTTGGTGTAGCTATTATTTATATTTATTTTGCAATGTTGAAAACTGTATAAATTAACGTGAAACTGAACTGATATCCTGACA[G/A]TTTTCTGCTGGGACATATTCCAACTATTAACAGAGTGACAAAGTCGGAAAGACATATGAACGACTTATTACTTATATGGTAAGAGCAAAACACTTAATTAATTAATTTATTTATTTAGCCTATTTATTTATTTATTTATTTGTTTGTTTGTTTATTTACATGACTAATGTCTTTCTTTCACCTTGCACCTACAAACTATGTCATAACCGTGTTCACCTTCTGAACTTGCACCTCGTCTCTTTCGACAACTTGATATTGCGGTTTTCCCAGTTCTCCGTCCCTCCACCTCTCTCAAAACCATGTTATTTTGGATTTTTGTCTTTTCTTTAACATAATTTCTCCTCGTATTGCATCTATTATATGAATTATTTCCCTTGTTAGTTCGGCCTATAAGTATAAATATTTAGATTACTATGAAATTATCAGTAGAATACTGCAACATTATCTTTTTGTACTAACTTAGTTAAGTGTCTTCACAAATACCAAGAAATCCTCCATAA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3107
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122892 Nonsense 207 491 7 15
Genomic Location (Zv9):
Chromosome 20 (position 5324862)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 5240455
GRCz11 20 5284862
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TAAATGATTACATTATCATTCACAGGTCGCTTTCGGTGTTGATTTGAACT[T/A]GTTTAAGCAAACAGACAACCCTTTCCAGCAGGCAATAGAGCAGTGTTTAC
Long Flanking Sequence:
CACGATTATCATGAGATTCTTATGAACACCCTCTTAAAATAAATTGTTACCCATGATTGCATCTTCTTAGGTTCTTGGGGTATGGCCTGGTGACAGCCACAGACCATGACATCTGGTACAGGCAGCGTCGAATCATGGATCCAGCCTTCAGCAGCTCGTGAGTCAAATACAGACCATCTCTGATACACACTGCAATGTGATTCTGATGCACCTCGACCGAGTTTGCCTTATCTGTCAGATACTTGCGAGGCTTGATAAGCACTTTTAATGAGATGTCAGAACGCCTGATGGACAAGCTGGAGGAAATGGCCATCAACAAAACCCCTGCCGTCATGCACGACCTGGTCAACTGTGTTACACTTGATATCATTTGCAAGGTTTCACTGTTCTTTTCGCTTATTCAAAGGAAAGTCTAATACAAGAGACATCAAACCAGCTGTTAATGATTACTAAATGATTACATTATCATTCACAGGTCGCTTTCGGTGTTGATTTGAACT[T/A]GTTTAAGCAAACAGACAACCCTTTCCAGCAGGCAATAGAGCAGTGTTTACAGGGTATGGTGTTAGATCTAAGAGACCCATTTTGTAAGGTAAGATAATTTATCTAAATATGATTATCACTATGACGAAAGAAGTAGGGTTAATGCTGTATAACCTGTTTTATTTTTAAATTGTGTTACCTTTTTAGTTTTTTCCCAAGAATTGGAAGGCTATACAGGAAACTAAAGGTGCTACTGTACTCTTACGTAAAACGGGAGAGCAATGGATACAAAACAGAAAGACAGCAGTGGAAATTGGAGAGGACGTCCCCAATGACATTCTCACACAAATCCTCAAAACTGCAAGTATGTTAGTTTTTTCACTTTGTTGAACAGGTACCATTTATAAACACACACCATTTATTCATTTCACAATTAAAGTAGTTAATTAATTAGTTTTAACCAAAAAGGAACAGATTCTATTATTTACTCATCCTCGTACAACACTGAGACCTTTGTTCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15302
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122892 Nonsense 354 491 11 15
Genomic Location (Zv9):
Chromosome 20 (position 5318139)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 5233732
GRCz11 20 5278139
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GCTAAAGCAGAGGTGGATGAAGTTCTTGGAACCAAAAGAGACATTTCATA[T/A]GAAGACCTTGGAAAATTCACTTATTTGTCTCAGGTTTGTCCACWGAGTTG
Long Flanking Sequence:
ACTGTAACAAGGAAACCTTAAAATAAAGTGCAACCCAGCAATTTGCTCTTTTGCAGGGCAAGAGACAACAGCCAATCAGCTCTCGTTTGCAATCATGGAATTAGGGAGACATCCTGAGATATATAAACGGTAAACACTTAAACATGGGTAACAATCTAAAATAATTTGAGTAACAATTTACACAATTAACTAGCTTATTACTTGCCTATTGTTATGATATTAACTGCTTTTTAGTAGTATAATCTTATTCGACATCTCTAAATGTAACTAGTTCCTAAACCCAACTACTACCTGAATTAATATGCAGATAATTGGTAGTTTACCTGATAGTCTTAGTTAATGGCTTGTTAATAGTGTGTTCATCAAAATAAAGTGCTACCGAAATACTGAATGGTTCCAAATATTTTGTATTAAAGTGCTTTAGAATTCAAACTTCTTTTCATTTCCAGAGCTAAAGCAGAGGTGGATGAAGTTCTTGGAACCAAAAGAGACATTTCATA[T/A]GAAGACCTTGGAAAATTCACTTATTTGTCTCAGGTTTGTCCACAGAGTTGTTTCAAGTGACATGAACAAAGGTTGCTTTTAGCATCCATTTCTTTTAATGGTCTTTTGTGTTGTTCAGGTGTTGAAGGAAACCCTGCGTCTGTACCCGACTGCGCCAGGAACCAATCGCTGGCTTCATGAGGACATGGTCATAAACGGCATTAAAATCCCTGGAGGCATTTCTGTTATTGTGAGTATCACCACATTCCTTGTAAGACCGTTCTGTTCACACACGATACCAGCCTACAGAGGCTAGTCATACAAGTACAAATCCTTTAAATCAGGGGTTTCAAACTCAATTCCTGGAGGGCCGAAGCCATGCACCGTTTAGTTCCCAACCTGCTCAAACACACACCTGTAGGTTTCAAACAAGCCTGAAGGACTCAACTAGTTTGATCAGGTGTGTTTAATTAGGGTTGGAACTAAACTGTGCAGAGCTGCGGCCCTTTTGGAACTGAGTT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa29303
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122892 Essential Splice Site 366 491 12 15
Genomic Location (Zv9):
Chromosome 20 (position 5318021)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 5233614
GRCz11 20 5278021
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAAGGTTGCTTTTAGCATCCATTTCTTTTAATGGTCTTTTGTGTTGTTCA[G/A]GTGTTGAAGGAAACCCTGCGTCTGTACCCGACTGCGCCAGGAACCAATCG
Long Flanking Sequence:
ATATATAAACGGTAAACACTTAAACATGGGTAACAATCTAAAATAATTTGAGTAACAATTTACACAATTAACTAGCTTATTACTTGCCTATTGTTATGATATTAACTGCTTTTTAGTAGTATAATCTTATTCGACATCTCTAAATGTAACTAGTTCCTAAACCCAACTACTACCTGAATTAATATGCAGATAATTGGTAGTTTACCTGATAGTCTTAGTTAATGGCTTGTTAATAGTGTGTTCATCAAAATAAAGTGCTACCGAAATACTGAATGGTTCCAAATATTTTGTATTAAAGTGCTTTAGAATTCAAACTTCTTTTCATTTCCAGAGCTAAAGCAGAGGTGGATGAAGTTCTTGGAACCAAAAGAGACATTTCATATGAAGACCTTGGAAAATTCACTTATTTGTCTCAGGTTTGTCCACAGAGTTGTTTCAAGTGACATGAACAAAGGTTGCTTTTAGCATCCATTTCTTTTAATGGTCTTTTGTGTTGTTCA[G/A]GTGTTGAAGGAAACCCTGCGTCTGTACCCGACTGCGCCAGGAACCAATCGCTGGCTTCATGAGGACATGGTCATAAACGGCATTAAAATCCCTGGAGGCATTTCTGTTATTGTGAGTATCACCACATTCCTTGTAAGACCGTTCTGTTCACACACGATACCAGCCTACAGAGGCTAGTCATACAAGTACAAATCCTTTAAATCAGGGGTTTCAAACTCAATTCCTGGAGGGCCGAAGCCATGCACCGTTTAGTTCCCAACCTGCTCAAACACACACCTGTAGGTTTCAAACAAGCCTGAAGGACTCAACTAGTTTGATCAGGTGTGTTTAATTAGGGTTGGAACTAAACTGTGCAGAGCTGCGGCCCTTTTGGAACTGAGTTTGACACCTGCGCTTTAAATTAAAATGAAGAAAGAAAGAAATGTTCATAGACCCTTTTTACAAAACAGCACTGATGATTTCAATAGTTGTAACATTCAGTCTGATAAAGACTGTGTTTA
Associated Phenotype:
Not determined