Busch Lab

ZMP

ERBB4 (3 of 5)

Ensembl ID:
ENSDARG00000089167
Description:
v-erb-a erythroblastic leukemia viral oncogene homolog 4 (avian) [Source:HGNC Symbol;Acc:3432]
Human Orthologue:
ERBB4
Human Description:
v-erb-a erythroblastic leukemia viral oncogene homolog 4 (avian) [Source:HGNC Symbol;Acc:3432]
Mouse Orthologue:
Erbb4
Mouse Description:
v-erb-a erythroblastic leukemia viral oncogene homolog 4 (avian) Gene [Source:MGI Symbol;Acc:MGI:104

Alleles

There are 7 alleles of this gene:

Allele Name Consequence Status Availability
sa24834 Nonsense Mutation detected in F1 DNA Not yet available
sa25517 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa32585 Nonsense Mutation detected in F1 DNA Not yet available
sa32584 Essential Splice Site Available for shipment Available now
sa6573 Nonsense Mutation detected in F1 DNA Not yet available
sa19414 Essential Splice Site Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3351
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092114 Nonsense 58 609 1 15
Genomic Location (Zv9):
Chromosome 1 (position 6280286)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 6661738
GRCz11 1 7345171
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CTCTRGCCATCTTTCTCAACTACAGACGAGACGGCTACTTCGGCCTGAGA[C/T]AGCTCGGCCTCAGGAACCTGACAGGTATAGTTGTCGGTTTATATCAGTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24834
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092114 Nonsense 150 609 4 15
Genomic Location (Zv9):
Chromosome 1 (position 6247146)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 6695735
GRCz11 1 7379168
KASP Assay ID:
554-7622.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACGAAGACGGTGTGTGCGGAGCAGTGTGACGGTCGATGTTTTGGACCGTA[T/G]GTCAGTAACTGCTGTCACCGTGAATGTGCAGGGGGCTGTTTCGGACCCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25517
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092114 Essential Splice Site 173 609 5 15
Genomic Location (Zv9):
Chromosome 1 (position 6246462)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 6696419
GRCz11 1 7379852
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTCATGTTTTATCCGTCAAACCTGAGCTCATGTGACTGTTTTCTGTTTTC[A/T]GGCTTGCACCAACTTTAATGACAGTGGTGCCTGCGTGACTCAATGTCCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32585
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092114 Nonsense 187 609 5 15
Genomic Location (Zv9):
Chromosome 1 (position 6246416)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 6696465
GRCz11 1 7379898
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTTCAGGCTTGCACCAACTTTAATGACAGTGGTGCCTGCGTGACTCAATG[T/A]CCTCAACCATTCGTCTACAATCCAACGACCTTCCAGCTCGAGCACAATCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32584
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092114 Essential Splice Site 258 609 7 15
Genomic Location (Zv9):
Chromosome 1 (position 6242806)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 6700459
GRCz11 1 7383892
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TAGTACAATACGGTATCTCATATGCCTGTGTATGTTTGTTTGTGGTGTTT[A/G]GTGTGTGATGGTATAGGAACCGGCAGCCTTCAATCAGCCCAAACTGTTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6573
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092114 Nonsense 371 609 10 15
Genomic Location (Zv9):
Chromosome 1 (position 6238826)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 6704440
GRCz11 1 7387873
KASP Assay ID:
554-4664.1 (used for ordering genotyping assays)
KASP Sequence:
CCAGTGGTATTTCTCTGCTGATCCTRAAGCAGCGCTGGATCACGTCTCTG[C/T]AGTTTCAGTCTCTGAGAGAGATCAGCGCYGGTAACGTCTACATGACCAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19414
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092114 Essential Splice Site 498 609 13 15
Genomic Location (Zv9):
Chromosome 1 (position 6220652)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 6722359
GRCz11 1 7405792
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CATTTTCAACAAGTTAAGTGTCATTCTCCTGTATTCTGTTTTCATGTTTT[A/G]GGGACCAGATCACTGTGTGAAGTGTCTGCATCTCAAAGACGGGCCCAACT
Associated Phenotype:
Not determined