Busch Lab

ZMP

si:dkeyp-89c11.2

Ensembl ID:
ENSDARG00000089159
ZFIN ID:
ZDB-GENE-041210-202
Description:
hypothetical protein LOC557184 [Source:RefSeq peptide;Acc:NP_001025281]
Human Orthologues:
ACOT1, ACOT2, ACOT4, ACOT6, BAAT
Human Descriptions:
acyl-CoA thioesterase 1 [Source:HGNC Symbol;Acc:33128]
acyl-CoA thioesterase 2 [Source:HGNC Symbol;Acc:18431]
acyl-CoA thioesterase 4 [Source:HGNC Symbol;Acc:19748]
acyl-CoA thioesterase 6 [Source:HGNC Symbol;Acc:33159]
bile acid CoA: amino acid N-acyltransferase (glycine N-choloyltransferase) [Source:HGNC Symbol;Acc:9
Mouse Orthologues:
Acnat1, Acnat2, Acot1, Acot2, Acot3, Acot4, Acot5, Acot6, Baat
Mouse Descriptions:
acyl-CoA thioesterase 1 Gene [Source:MGI Symbol;Acc:MGI:1349396]
acyl-CoA thioesterase 2 Gene [Source:MGI Symbol;Acc:MGI:2159605]
acyl-CoA thioesterase 3 Gene [Source:MGI Symbol;Acc:MGI:2159619]
acyl-CoA thioesterase 4 Gene [Source:MGI Symbol;Acc:MGI:2159621]
acyl-CoA thioesterase 5 Gene [Source:MGI Symbol;Acc:MGI:2384969]
acyl-CoA thioesterase 6 Gene [Source:MGI Symbol;Acc:MGI:1921287]
acyl-coenzyme A amino acid N-acyltransferase 1 Gene [Source:MGI Symbol;Acc:MGI:2140197]
acyl-coenzyme A amino acid N-acyltransferase 2 Gene [Source:MGI Symbol;Acc:MGI:2444345]
bile acid-Coenzyme A: amino acid N-acyltransferase Gene [Source:MGI Symbol;Acc:MGI:106642]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa18000 Nonsense Available for shipment Available now
sa6948 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa18000
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028297 Nonsense 36 449 2 12
ENSDART00000044739 Nonsense 36 439 2 11
ENSDART00000133929 Nonsense 36 439 3 12

The following transcripts of ENSDARG00000089159 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 4 (position 24695977)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 25619646
GRCz11 4 25608844
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CTGTGAGCACTGAGAGTAGGAGATGTCCTCTGTTAACTGTTCAGCCAYGT[C/T]GAGGAATGGTGGACGAGAAAATTCAGATTATCATAAGGAATTTACTGCCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6948
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028297 Nonsense 54 449 2 12
ENSDART00000044739 Nonsense 54 439 2 11
ENSDART00000133929 Nonsense 54 439 3 12

The following transcripts of ENSDARG00000089159 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 4 (position 24696031)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 25619700
GRCz11 4 25608898
KASP Assay ID:
554-4585.1 (used for ordering genotyping assays)
KASP Sequence:
GAATGGTGGACGAGAAAATTCAGATTATCATAAGGAATTTACTGCCCAAT[C/T]AAGAGGTAACGSTACACTCTCTACATCAGTCTGAAGATAAGGACTTCTGG
Associated Phenotype:
Not determined