Busch Lab

ZMP

STC2 (2 of 2)

Ensembl ID:
ENSDARG00000089134
Description:
stanniocalcin 2 [Source:HGNC Symbol;Acc:11374]
Human Orthologue:
STC2
Human Description:
stanniocalcin 2 [Source:HGNC Symbol;Acc:11374]
Mouse Orthologue:
Stc2
Mouse Description:
stanniocalcin 2 Gene [Source:MGI Symbol;Acc:MGI:1316731]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa24026 Nonsense Available for shipment Available now
sa7485 Missense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa24026
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128119 Nonsense 10 313 1 4
Genomic Location (Zv9):
Chromosome 21 (position 39915285)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 41115443
GRCz11 21 41512324
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGTGCTTCGTTTGAACTGCGGTTATGCTCCAGTGGTCTGGCAGTCCGAGA[C/T]AGCGCTACATTCAACAGCGTTCATCACCGTCGCGAGACATGCGTGCGCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7485
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > C
Consequence:
Missense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128119 Missense 170 313 3 4
Genomic Location (Zv9):
Chromosome 21 (position 39927586)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 41127731
GRCz11 21 41524612
KASP Assay ID:
554-4381.1 (used for ordering genotyping assays)
KASP Sequence:
CCAGCTTCAGCGCGAGTGTTACCTCAAACACAACCTCTGCTTGGCCGTGA[G/C]GGAGAACGTCAACGTCATGGTGGAGATGATCCATTTCAAGGACCTGTTTC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4967
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128119 Essential Splice Site 189 313 3 4
Genomic Location (Zv9):
Chromosome 21 (position 39927645)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 41127790
GRCz11 21 41524671
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TCAACGTCATGGTGGAGATGATCCATTTCAAGGACCTGTTTCCTAAAGGG[T/A]GAGTCCTTCAATGTCATGTTGTGATGAGATATACAGCCAAAAATAATATG
Associated Phenotype:
Not determined