Busch Lab

ZMP

si:ch211-160j14.3

Ensembl ID:
ENSDARG00000089078
ZFIN ID:
ZDB-GENE-091204-86
Human Orthologue:
COL23A1
Human Description:
collagen, type XXIII, alpha 1 [Source:HGNC Symbol;Acc:22990]
Mouse Orthologue:
Col23a1
Mouse Description:
collagen, type XXIII, alpha 1 Gene [Source:MGI Symbol;Acc:MGI:2653243]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa18363 Essential Splice Site Available for shipment Available now
sa43681 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa43680 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa18363
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123419 Essential Splice Site 72 285 4 17
ENSDART00000147387 None None 235 None 14
Genomic Location (Zv9):
Chromosome 21 (position 30865440)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 32064910
GRCz11 21 32098168
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CTGGATTCTCAGAAACTGATGATTTTGCTGTTCGTTTCAAAGCTCTGCAG[G/A]TACATTTTTCAACCAAAGATCTTCRACSGTGCACYTGAAGGCCCACTATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43681
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123419 Essential Splice Site 100 285 7 17
ENSDART00000147387 Essential Splice Site 28 235 3 14
Genomic Location (Zv9):
Chromosome 21 (position 30864922)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 32064392
GRCz11 21 32097650
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGTACTCATTCAGACACCTTTACTGCATAATGTAATGTGTTATCTTATCT[A/T]GGGCCAAAAGGGAGAGAGAGGTGATGTTGGGGAGCCTGGAGCAGCAGGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43680
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123419 Essential Splice Site 172 285 10 17
ENSDART00000147387 Essential Splice Site 100 235 6 14
Genomic Location (Zv9):
Chromosome 21 (position 30864423)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 32063893
GRCz11 21 32097151
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAACCTTCTTCCAAATATTCCAGGGATATCATGGACTGCCTGGATCCAAG[G/A]TGGGTTCTGTGGGTGAAACTGTGAAACGCTTTTGTAAAGAAAAAATGTTT
Associated Phenotype:
Not determined